Incidental Mutation 'R9143:Zzz3'
ID 694438
Institutional Source Beutler Lab
Gene Symbol Zzz3
Ensembl Gene ENSMUSG00000039068
Gene Name zinc finger, ZZ domain containing 3
Synonyms 3110065C23Rik, 6430567E01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9143 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 152395473-152462826 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 152458271 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 869 (I869T)
Ref Sequence ENSEMBL: ENSMUSP00000101706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045262] [ENSMUST00000089982] [ENSMUST00000106100] [ENSMUST00000106101] [ENSMUST00000106103] [ENSMUST00000200570]
AlphaFold Q6KAQ7
Predicted Effect probably benign
Transcript: ENSMUST00000045262
SMART Domains Protein: ENSMUSP00000042785
Gene: ENSMUSG00000039058

DomainStartEndE-ValueType
Pfam:AAA_17 134 263 1.1e-8 PFAM
Pfam:AAA_18 135 274 3e-10 PFAM
Pfam:ADK 137 294 5.8e-35 PFAM
Pfam:AAA_17 378 525 2.9e-8 PFAM
Pfam:ADK 381 537 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089982
AA Change: I868T

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000087428
Gene: ENSMUSG00000039068
AA Change: I868T

DomainStartEndE-ValueType
SANT 657 711 1.42e-9 SMART
low complexity region 776 787 N/A INTRINSIC
low complexity region 799 814 N/A INTRINSIC
ZnF_ZZ 823 871 6.46e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106100
AA Change: I869T

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101706
Gene: ENSMUSG00000039068
AA Change: I869T

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106101
AA Change: I869T

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101707
Gene: ENSMUSG00000039068
AA Change: I869T

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106103
AA Change: I368T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101709
Gene: ENSMUSG00000039068
AA Change: I368T

DomainStartEndE-ValueType
SANT 157 211 1.42e-9 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
ZnF_ZZ 323 371 6.46e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200570
AA Change: I372T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143693
Gene: ENSMUSG00000039068
AA Change: I372T

DomainStartEndE-ValueType
SANT 161 215 1.42e-9 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
ZnF_ZZ 327 375 6.46e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik T C 17: 48,145,434 I111M probably damaging Het
Arid2 A G 15: 96,361,834 I292V probably damaging Het
Atl3 T C 19: 7,532,043 S379P probably benign Het
Btbd16 C T 7: 130,815,786 R344C probably damaging Het
Ccnt1 G A 15: 98,543,807 H527Y probably damaging Het
Ces1d T A 8: 93,186,079 I244F probably damaging Het
Clec16a C A 16: 10,611,100 S449R probably damaging Het
Col15a1 G C 4: 47,288,200 probably benign Het
Dsp C A 13: 38,193,361 S1707R probably benign Het
E330034G19Rik A T 14: 24,296,936 Q162L possibly damaging Het
F830045P16Rik T C 2: 129,474,582 N69S probably benign Het
Galnt10 C T 11: 57,721,320 T62I probably benign Het
Gm19668 T C 10: 77,799,126 D3G unknown Het
Hace1 T A 10: 45,686,668 F760I probably damaging Het
Il20rb A G 9: 100,474,883 Y65H probably damaging Het
Insl5 C A 4: 103,026,644 V27L probably benign Het
Jade2 T C 11: 51,825,103 D425G probably benign Het
Lipg T C 18: 74,954,201 K183R probably benign Het
Lrrc59 T A 11: 94,634,630 L84Q probably damaging Het
Lyst T A 13: 13,661,165 F1811I probably damaging Het
Nfil3 A G 13: 52,967,756 S371P probably benign Het
Nin A G 12: 70,090,575 S76P Het
Nuak1 C T 10: 84,378,087 probably null Het
Olfr27 A T 9: 39,144,426 I109F possibly damaging Het
Rcvrn T C 11: 67,700,064 F158S possibly damaging Het
Skap2 T C 6: 51,908,429 T200A probably benign Het
Spag17 C T 3: 100,027,590 T704M probably benign Het
Stxbp1 A G 2: 32,798,145 S503P probably damaging Het
Susd5 A T 9: 114,095,811 E254V possibly damaging Het
Sv2a T C 3: 96,190,667 S529P possibly damaging Het
Tigd2 T A 6: 59,211,325 N392K probably benign Het
Tmem131l A G 3: 83,934,913 L525P probably benign Het
Tonsl T C 15: 76,630,624 M1127V probably damaging Het
Top2a T A 11: 99,009,879 E585V probably benign Het
Usp19 T G 9: 108,498,199 L847R probably damaging Het
Vta1 T C 10: 14,676,032 H141R possibly damaging Het
Other mutations in Zzz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Zzz3 APN 3 152428514 missense probably benign 0.16
IGL00707:Zzz3 APN 3 152449043 nonsense probably null
IGL00983:Zzz3 APN 3 152455810 splice site probably benign
IGL01586:Zzz3 APN 3 152455839 missense possibly damaging 0.80
IGL01973:Zzz3 APN 3 152428370 missense probably benign 0.00
IGL02002:Zzz3 APN 3 152451369 missense probably damaging 0.98
IGL02009:Zzz3 APN 3 152428115 missense possibly damaging 0.80
IGL02260:Zzz3 APN 3 152452083 missense probably benign 0.04
IGL02336:Zzz3 APN 3 152428059 missense possibly damaging 0.74
IGL02454:Zzz3 APN 3 152428574 missense probably benign 0.03
IGL02519:Zzz3 APN 3 152427390 missense probably damaging 1.00
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0314:Zzz3 UTSW 3 152427448 missense probably benign 0.00
R0536:Zzz3 UTSW 3 152448828 missense probably damaging 1.00
R1706:Zzz3 UTSW 3 152449098 missense probably damaging 1.00
R2869:Zzz3 UTSW 3 152446844 synonymous silent
R2870:Zzz3 UTSW 3 152446844 synonymous silent
R2871:Zzz3 UTSW 3 152446844 synonymous silent
R2872:Zzz3 UTSW 3 152446844 synonymous silent
R3927:Zzz3 UTSW 3 152455862 missense probably damaging 1.00
R4195:Zzz3 UTSW 3 152428465 missense probably benign 0.02
R4768:Zzz3 UTSW 3 152448783 missense probably damaging 1.00
R5248:Zzz3 UTSW 3 152427545 missense probably damaging 0.99
R5566:Zzz3 UTSW 3 152455824 missense probably damaging 1.00
R5752:Zzz3 UTSW 3 152452122 missense possibly damaging 0.48
R5782:Zzz3 UTSW 3 152428100 missense possibly damaging 0.69
R5884:Zzz3 UTSW 3 152450658 missense probably damaging 1.00
R6008:Zzz3 UTSW 3 152428151 missense probably benign 0.01
R6155:Zzz3 UTSW 3 152427682 missense possibly damaging 0.57
R6557:Zzz3 UTSW 3 152428460 missense probably damaging 1.00
R6865:Zzz3 UTSW 3 152428053 missense probably benign 0.01
R7344:Zzz3 UTSW 3 152452099 missense probably damaging 0.98
R7588:Zzz3 UTSW 3 152422768 missense possibly damaging 0.85
R7636:Zzz3 UTSW 3 152427652 missense probably benign
R7732:Zzz3 UTSW 3 152448842 missense probably damaging 1.00
R8157:Zzz3 UTSW 3 152449648 missense probably null 0.71
R8490:Zzz3 UTSW 3 152428653 nonsense probably null
R8926:Zzz3 UTSW 3 152427892 missense possibly damaging 0.76
R9243:Zzz3 UTSW 3 152428283 missense probably damaging 1.00
X0018:Zzz3 UTSW 3 152428733 missense possibly damaging 0.88
Z1176:Zzz3 UTSW 3 152449097 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACCAGATCTCAAGCAACTTTCTG -3'
(R):5'- CTGTACTGGACGAGAACACTC -3'

Sequencing Primer
(F):5'- GCAACTTTCTGTTAAAACTTTCTGAG -3'
(R):5'- ATGCTGTGAGTGTCCAAACC -3'
Posted On 2022-01-20