Incidental Mutation 'R9144:Gldc'
ID 694529
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms b2b2679Clo, D030049L12Rik, D19Wsu57e
MMRRC Submission 068935-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9144 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 30075847-30152829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30114593 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 439 (F439S)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: F439S

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 C T 9: 44,192,708 (GRCm39) V176M possibly damaging Het
Acp5 T C 9: 22,041,242 (GRCm39) T62A probably benign Het
Alad A T 4: 62,430,257 (GRCm39) D88E probably damaging Het
Arap1 T C 7: 101,047,602 (GRCm39) I803T probably damaging Het
Bckdhb C A 9: 83,894,662 (GRCm39) T312K probably damaging Het
Cfap206 A G 4: 34,722,667 (GRCm39) V138A possibly damaging Het
Cntnap5b A G 1: 99,978,512 (GRCm39) Y176C probably damaging Het
Creld1 A T 6: 113,461,468 (GRCm39) T63S probably damaging Het
Dsc1 G A 18: 20,218,639 (GRCm39) T878I possibly damaging Het
Ehbp1 C T 11: 22,018,463 (GRCm39) R873H probably damaging Het
Eml2 T C 7: 18,935,564 (GRCm39) V466A possibly damaging Het
Ercc5 T A 1: 44,213,511 (GRCm39) Y836N probably damaging Het
Fgf20 T C 8: 40,732,958 (GRCm39) D160G Het
Fgfr4 A T 13: 55,315,837 (GRCm39) probably null Het
Fpr1 A T 17: 18,097,626 (GRCm39) V121D probably damaging Het
Gabbr1 A G 17: 37,362,049 (GRCm39) K218E probably benign Het
Galnt12 T C 4: 47,113,822 (GRCm39) L372P Het
Gm6465 A G 5: 11,896,726 (GRCm39) T32A possibly damaging Het
Has2 T C 15: 56,545,588 (GRCm39) R5G probably benign Het
Hexb T C 13: 97,317,599 (GRCm39) Y366C probably damaging Het
Ier2 C T 8: 85,389,266 (GRCm39) V39I probably benign Het
Ifi214 A G 1: 173,355,434 (GRCm39) S125P possibly damaging Het
Kcnk15 A G 2: 163,700,451 (GRCm39) D230G probably benign Het
Kdm3b A T 18: 34,927,558 (GRCm39) Y140F probably benign Het
Klk1b11 T C 7: 43,427,055 (GRCm39) V140A probably damaging Het
Klra5 C T 6: 129,886,911 (GRCm39) C39Y probably benign Het
Ltbp2 T C 12: 84,856,426 (GRCm39) I699M probably damaging Het
Mak C A 13: 41,201,594 (GRCm39) E256* probably null Het
Mark3 C A 12: 111,606,376 (GRCm39) N496K probably benign Het
Mex3c A G 18: 73,723,397 (GRCm39) T497A probably benign Het
Myt1 A G 2: 181,467,805 (GRCm39) I1160V possibly damaging Het
Notch1 T C 2: 26,349,587 (GRCm39) T2518A probably benign Het
Nsg1 A G 5: 38,302,088 (GRCm39) Y108H probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Obscn A G 11: 58,960,103 (GRCm39) S3255P possibly damaging Het
Or5w18 A G 2: 87,633,482 (GRCm39) T246A probably benign Het
Plxna4 A G 6: 32,162,496 (GRCm39) V1339A possibly damaging Het
Ppp2r5e C T 12: 75,506,468 (GRCm39) R433H possibly damaging Het
Pwwp2a T A 11: 43,596,721 (GRCm39) C629S probably benign Het
Rasl10a T A 11: 5,008,473 (GRCm39) S56R probably benign Het
Rhob A G 12: 8,549,124 (GRCm39) V170A probably damaging Het
Rlf A T 4: 121,003,900 (GRCm39) N1803K probably benign Het
Rmdn3 G T 2: 118,969,847 (GRCm39) Q405K probably benign Het
Rpap3 G A 15: 97,589,184 (GRCm39) T250M possibly damaging Het
Rraga T C 4: 86,494,796 (GRCm39) I214T probably damaging Het
Rundc3a A T 11: 102,290,862 (GRCm39) Q315L probably benign Het
Sh3bgr T A 16: 96,001,931 (GRCm39) S10T probably benign Het
Skint6 A T 4: 112,985,102 (GRCm39) S421R possibly damaging Het
Spag16 G C 1: 70,420,459 (GRCm39) L482F probably damaging Het
Sppl2a A G 2: 126,769,743 (GRCm39) S38P probably benign Het
Tex14 T A 11: 87,413,423 (GRCm39) probably null Het
Tmem181a G A 17: 6,346,048 (GRCm39) V181M possibly damaging Het
Traf3 T A 12: 111,228,294 (GRCm39) S502T probably benign Het
Trav9n-4 T G 14: 53,532,236 (GRCm39) V30G probably damaging Het
Trpm2 C A 10: 77,765,122 (GRCm39) V960L probably benign Het
Unc13b T A 4: 43,173,649 (GRCm39) D1492E unknown Het
Usp44 A G 10: 93,681,645 (GRCm39) T32A probably benign Het
Vmn1r38 A G 6: 66,753,612 (GRCm39) M168T probably benign Het
Vmn1r9 A G 6: 57,048,788 (GRCm39) I288V probably benign Het
Zfhx3 A G 8: 109,676,794 (GRCm39) T2615A possibly damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30,092,640 (GRCm39) missense probably damaging 1.00
IGL01016:Gldc APN 19 30,110,893 (GRCm39) missense possibly damaging 0.93
IGL01112:Gldc APN 19 30,135,913 (GRCm39) critical splice donor site probably null
IGL01510:Gldc APN 19 30,091,121 (GRCm39) critical splice donor site probably null
IGL01516:Gldc APN 19 30,076,432 (GRCm39) missense probably damaging 1.00
IGL01598:Gldc APN 19 30,111,156 (GRCm39) missense probably damaging 1.00
IGL01646:Gldc APN 19 30,078,165 (GRCm39) missense possibly damaging 0.61
IGL02024:Gldc APN 19 30,078,227 (GRCm39) missense probably damaging 1.00
IGL02125:Gldc APN 19 30,124,641 (GRCm39) missense probably benign 0.03
IGL02548:Gldc APN 19 30,077,299 (GRCm39) missense probably benign
IGL02711:Gldc APN 19 30,122,546 (GRCm39) critical splice donor site probably null
IGL02818:Gldc APN 19 30,113,909 (GRCm39) missense probably damaging 0.99
IGL02982:Gldc APN 19 30,122,545 (GRCm39) critical splice donor site probably null
IGL03165:Gldc APN 19 30,076,393 (GRCm39) missense possibly damaging 0.61
jojoba UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
miserable UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
Urchin UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
I2289:Gldc UTSW 19 30,124,576 (GRCm39) nonsense probably null
R0180:Gldc UTSW 19 30,078,217 (GRCm39) missense possibly damaging 0.95
R0269:Gldc UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
R0277:Gldc UTSW 19 30,093,851 (GRCm39) missense possibly damaging 0.84
R1085:Gldc UTSW 19 30,128,828 (GRCm39) missense probably damaging 1.00
R1159:Gldc UTSW 19 30,138,162 (GRCm39) intron probably benign
R1500:Gldc UTSW 19 30,091,225 (GRCm39) missense possibly damaging 0.88
R1507:Gldc UTSW 19 30,096,038 (GRCm39) missense probably damaging 1.00
R1592:Gldc UTSW 19 30,138,077 (GRCm39) intron probably benign
R1593:Gldc UTSW 19 30,091,150 (GRCm39) missense probably damaging 1.00
R1675:Gldc UTSW 19 30,120,853 (GRCm39) missense probably damaging 1.00
R1869:Gldc UTSW 19 30,116,732 (GRCm39) missense probably benign
R1965:Gldc UTSW 19 30,114,513 (GRCm39) nonsense probably null
R2312:Gldc UTSW 19 30,078,226 (GRCm39) missense probably damaging 0.98
R2425:Gldc UTSW 19 30,109,190 (GRCm39) missense probably damaging 1.00
R3836:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3837:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3839:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R4191:Gldc UTSW 19 30,123,058 (GRCm39) missense probably damaging 0.96
R4380:Gldc UTSW 19 30,138,168 (GRCm39) intron probably benign
R4508:Gldc UTSW 19 30,120,807 (GRCm39) missense probably damaging 1.00
R4570:Gldc UTSW 19 30,151,839 (GRCm39) missense probably benign
R4655:Gldc UTSW 19 30,138,102 (GRCm39) intron probably benign
R4842:Gldc UTSW 19 30,111,132 (GRCm39) missense possibly damaging 0.94
R5070:Gldc UTSW 19 30,095,998 (GRCm39) missense possibly damaging 0.84
R5085:Gldc UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
R5268:Gldc UTSW 19 30,123,125 (GRCm39) missense probably damaging 0.96
R5368:Gldc UTSW 19 30,135,921 (GRCm39) missense probably benign
R5718:Gldc UTSW 19 30,088,172 (GRCm39) nonsense probably null
R5878:Gldc UTSW 19 30,120,867 (GRCm39) splice site probably null
R6192:Gldc UTSW 19 30,111,172 (GRCm39) missense probably damaging 0.98
R6453:Gldc UTSW 19 30,093,917 (GRCm39) missense probably damaging 0.99
R6777:Gldc UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
R6865:Gldc UTSW 19 30,111,162 (GRCm39) missense possibly damaging 0.92
R7332:Gldc UTSW 19 30,093,926 (GRCm39) missense probably damaging 0.99
R7390:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.46
R7647:Gldc UTSW 19 30,096,067 (GRCm39) missense probably damaging 0.96
R8081:Gldc UTSW 19 30,135,987 (GRCm39) frame shift probably null
R8171:Gldc UTSW 19 30,111,161 (GRCm39) missense probably benign 0.24
R8321:Gldc UTSW 19 30,120,807 (GRCm39) nonsense probably null
R8374:Gldc UTSW 19 30,114,594 (GRCm39) missense probably damaging 1.00
R8503:Gldc UTSW 19 30,077,254 (GRCm39) missense probably benign 0.26
R8510:Gldc UTSW 19 30,093,905 (GRCm39) missense probably damaging 1.00
R8785:Gldc UTSW 19 30,092,634 (GRCm39) missense probably damaging 1.00
R8818:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8820:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8829:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8830:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8859:Gldc UTSW 19 30,116,779 (GRCm39) missense probably damaging 1.00
R8887:Gldc UTSW 19 30,111,156 (GRCm39) missense possibly damaging 0.94
R8935:Gldc UTSW 19 30,109,093 (GRCm39) missense probably benign 0.00
R8940:Gldc UTSW 19 30,128,884 (GRCm39) missense probably benign
R9070:Gldc UTSW 19 30,080,404 (GRCm39) missense probably damaging 1.00
R9100:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.81
R9163:Gldc UTSW 19 30,111,686 (GRCm39) missense probably benign 0.13
R9429:Gldc UTSW 19 30,091,172 (GRCm39) missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30,123,148 (GRCm39) missense possibly damaging 0.61
Z1177:Gldc UTSW 19 30,088,179 (GRCm39) missense probably damaging 0.99
Z1177:Gldc UTSW 19 30,088,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGGACAATCTGCTTCTTTG -3'
(R):5'- ACAATGAGATTGCACCCATTTC -3'

Sequencing Primer
(F):5'- GAGGACAATCTGCTTCTTTGAAAAG -3'
(R):5'- TGAGATTGCACCCATTTCTAATATG -3'
Posted On 2022-01-20