Incidental Mutation 'R9145:Ttll4'
ID 694533
Institutional Source Beutler Lab
Gene Symbol Ttll4
Ensembl Gene ENSMUSG00000033257
Gene Name tubulin tyrosine ligase-like family, member 4
Synonyms 4632407P03Rik
Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock # R9145 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 74661745-74703730 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74679790 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 267 (K267E)
Ref Sequence ENSEMBL: ENSMUSP00000037406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]
AlphaFold Q80UG8
Predicted Effect probably benign
Transcript: ENSMUST00000042125
AA Change: K267E

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: K267E

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 645 940 2.2e-106 PFAM
low complexity region 942 961 N/A INTRINSIC
low complexity region 1103 1113 N/A INTRINSIC
low complexity region 1168 1182 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113678
AA Change: K267E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: K267E

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 636 876 3.4e-82 PFAM
low complexity region 878 897 N/A INTRINSIC
low complexity region 1039 1049 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129890
SMART Domains Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257

DomainStartEndE-ValueType
low complexity region 69 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141119
SMART Domains Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257

DomainStartEndE-ValueType
low complexity region 56 96 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,559,069 H720L probably benign Het
Abca15 T C 7: 120,388,165 Y1225H probably benign Het
Adck1 C A 12: 88,368,423 N26K probably benign Het
Adcy3 A G 12: 4,195,208 D382G probably damaging Het
Ahi1 T A 10: 21,000,589 C800S probably benign Het
Ahnak G T 19: 9,014,923 V4524L probably benign Het
Apol11a C T 15: 77,513,578 A43V probably benign Het
Arid1a T C 4: 133,693,903 M479V unknown Het
Atp13a2 T A 4: 140,996,745 C324S probably damaging Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
C2cd2 T G 16: 97,876,286 T413P probably damaging Het
Cct5 A C 15: 31,590,961 D531E Het
Chst1 A T 2: 92,614,178 I332F probably damaging Het
Col12a1 A T 9: 79,620,062 V2662D probably benign Het
Cts3 A G 13: 61,564,986 Y307H probably benign Het
Dhx9 A G 1: 153,461,080 I807T probably damaging Het
Doxl2 C A 6: 48,975,956 R272S probably benign Het
Exoc3l4 T C 12: 111,422,152 L25P probably benign Het
Ggcx T A 6: 72,425,922 C288S probably benign Het
Gjb3 A G 4: 127,326,347 Y131H probably damaging Het
Hdhd3 A G 4: 62,499,337 S201P probably benign Het
Helz2 A T 2: 181,240,055 V315E probably damaging Het
Hsp90aa1 A G 12: 110,696,250 probably null Het
Il12a C T 3: 68,691,542 R19W unknown Het
Isoc1 C T 18: 58,673,275 A219V possibly damaging Het
Jup T A 11: 100,378,298 T430S probably benign Het
Klra5 C T 6: 129,909,948 C39Y probably benign Het
Map4 A T 9: 110,026,200 Q131L probably damaging Het
Mau2 T A 8: 70,027,515 K314M probably damaging Het
Mga A G 2: 119,964,012 M2726V probably benign Het
Mgme1 G A 2: 144,272,485 probably null Het
Msrb2 A G 2: 19,394,255 E143G probably benign Het
Muc5b G T 7: 141,857,613 C1432F unknown Het
Naglu T C 11: 101,071,114 Y138H probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nlrp1b A G 11: 71,218,367 Y103H probably benign Het
Nodal A G 10: 61,423,680 N299D probably damaging Het
Notch1 T C 2: 26,459,575 T2518A probably benign Het
Nr2e1 A C 10: 42,572,952 S97A probably benign Het
Nuak1 A T 10: 84,374,723 S500R probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Nyap1 T C 5: 137,737,913 E104G probably benign Het
Olfr401 C T 11: 74,121,700 T137I probably benign Het
Olfr670 T A 7: 104,959,997 H245L probably damaging Het
Palld T C 8: 61,877,073 T257A probably benign Het
Pbx3 C T 2: 34,371,806 G39S probably benign Het
Pcnx4 C T 12: 72,556,269 P435L probably damaging Het
Piezo1 T C 8: 122,482,014 T2538A unknown Het
Plagl1 T C 10: 13,128,128 L380P unknown Het
Polrmt G T 10: 79,740,581 Q514K probably benign Het
Psg17 T G 7: 18,819,926 D133A probably benign Het
Rab3b G A 4: 108,940,706 D185N probably benign Het
Ranbp2 T A 10: 58,455,914 S248T probably benign Het
Rdh10 C A 1: 16,129,206 A212D probably damaging Het
Rinl A G 7: 28,795,664 H154R Het
Selenbp1 T C 3: 94,944,103 M389T probably benign Het
Serpina1c T A 12: 103,896,141 H305L possibly damaging Het
Sh3rf2 T A 18: 42,149,681 S467T Het
Sipa1l1 A G 12: 82,396,561 D875G probably benign Het
Slc10a6 A T 5: 103,628,934 V100D probably damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Slc20a2 T C 8: 22,540,431 F168L probably benign Het
Slc25a1 A T 16: 17,927,244 probably null Het
Slc5a12 A G 2: 110,640,897 S495G probably benign Het
Smpdl3a A G 10: 57,800,932 D42G possibly damaging Het
Spag16 G C 1: 70,381,300 L482F probably damaging Het
Susd5 G A 9: 114,096,221 G391R probably damaging Het
Sync G T 4: 129,293,825 A217S Het
Tha1 T A 11: 117,868,686 N326Y probably damaging Het
Tjp1 A T 7: 65,302,816 F1590Y probably benign Het
Tle4 T C 19: 14,468,219 N221S probably benign Het
Tln1 T C 4: 43,536,024 T2054A probably damaging Het
Ttc30a1 A T 2: 75,980,079 Y553* probably null Het
Usp32 C T 11: 85,022,292 G930D probably damaging Het
Vmn2r75 T C 7: 86,164,239 N452D probably damaging Het
Vmn2r81 T C 10: 79,268,194 L217P possibly damaging Het
Wnt2 T A 6: 18,030,398 probably benign Het
Zfp459 C T 13: 67,408,616 S116N probably benign Het
Other mutations in Ttll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Ttll4 APN 1 74685893 missense probably damaging 1.00
IGL01743:Ttll4 APN 1 74688193 missense possibly damaging 0.63
IGL01914:Ttll4 APN 1 74679058 missense probably benign 0.01
IGL02288:Ttll4 APN 1 74679401 missense probably benign 0.05
IGL02621:Ttll4 APN 1 74687484 missense probably damaging 1.00
IGL02662:Ttll4 APN 1 74687231 splice site probably null
IGL02890:Ttll4 APN 1 74687339 nonsense probably null
IGL02937:Ttll4 APN 1 74679503 missense possibly damaging 0.92
IGL03178:Ttll4 APN 1 74680408 missense probably damaging 0.96
IGL03412:Ttll4 APN 1 74687321 missense probably benign 0.28
1mM(1):Ttll4 UTSW 1 74689980 missense probably null 1.00
R0083:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0108:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0135:Ttll4 UTSW 1 74679928 missense possibly damaging 0.86
R0137:Ttll4 UTSW 1 74679692 missense possibly damaging 0.74
R0306:Ttll4 UTSW 1 74696757 missense probably benign 0.28
R0506:Ttll4 UTSW 1 74688618 missense probably benign 0.06
R0555:Ttll4 UTSW 1 74688280 missense probably damaging 1.00
R1617:Ttll4 UTSW 1 74679401 missense probably benign 0.05
R1649:Ttll4 UTSW 1 74697470 missense possibly damaging 0.52
R1793:Ttll4 UTSW 1 74687840 missense possibly damaging 0.91
R1898:Ttll4 UTSW 1 74697482 missense probably benign 0.01
R1952:Ttll4 UTSW 1 74687559 missense probably damaging 0.99
R1987:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R1989:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R2067:Ttll4 UTSW 1 74680382 missense possibly damaging 0.94
R2162:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R2185:Ttll4 UTSW 1 74679829 missense possibly damaging 0.54
R2875:Ttll4 UTSW 1 74686438 splice site probably null
R2876:Ttll4 UTSW 1 74686438 splice site probably null
R2895:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R2896:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R3157:Ttll4 UTSW 1 74697611 missense possibly damaging 0.81
R3832:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R4707:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4784:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4785:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R5176:Ttll4 UTSW 1 74679286 missense probably damaging 0.99
R5202:Ttll4 UTSW 1 74687852 critical splice donor site probably null
R5244:Ttll4 UTSW 1 74696448 missense probably benign 0.30
R5264:Ttll4 UTSW 1 74686376 missense possibly damaging 0.92
R5452:Ttll4 UTSW 1 74679321 missense probably benign 0.06
R5992:Ttll4 UTSW 1 74685391 missense probably damaging 1.00
R6111:Ttll4 UTSW 1 74697539 missense possibly damaging 0.95
R6722:Ttll4 UTSW 1 74681789 missense possibly damaging 0.95
R6776:Ttll4 UTSW 1 74681353 missense probably damaging 1.00
R6815:Ttll4 UTSW 1 74679349 missense possibly damaging 0.89
R6836:Ttll4 UTSW 1 74689413 missense probably damaging 0.98
R6963:Ttll4 UTSW 1 74681816 missense probably damaging 1.00
R7271:Ttll4 UTSW 1 74688661 missense possibly damaging 0.83
R7508:Ttll4 UTSW 1 74687259 missense possibly damaging 0.81
R7714:Ttll4 UTSW 1 74679413 missense probably benign 0.00
R7837:Ttll4 UTSW 1 74681757 critical splice acceptor site probably null
R8032:Ttll4 UTSW 1 74696473 missense possibly damaging 0.82
R8036:Ttll4 UTSW 1 74679230 missense probably benign 0.02
R8115:Ttll4 UTSW 1 74687330 nonsense probably null
R8949:Ttll4 UTSW 1 74681816 missense probably damaging 0.99
R9156:Ttll4 UTSW 1 74680066 missense probably benign 0.00
R9329:Ttll4 UTSW 1 74685962 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGATTGCATCTCCACTGTCC -3'
(R):5'- CTCACAGCCTCAGTGAAGTG -3'

Sequencing Primer
(F):5'- AGATTGCATCTCCACTGTCCTATAAG -3'
(R):5'- AGCCTCAGTGAAGTGTACCTC -3'
Posted On 2022-01-20