Incidental Mutation 'R9145:Piezo1'
ID 694572
Institutional Source Beutler Lab
Gene Symbol Piezo1
Ensembl Gene ENSMUSG00000014444
Gene Name piezo-type mechanosensitive ion channel component 1
Synonyms Fam38a, Piezo1
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9145 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 123208437-123278068 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123208753 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 2538 (T2538A)
Ref Sequence ENSEMBL: ENSMUSP00000114584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067252] [ENSMUST00000116412] [ENSMUST00000127664] [ENSMUST00000128383] [ENSMUST00000134127] [ENSMUST00000136253] [ENSMUST00000156333] [ENSMUST00000146634] [ENSMUST00000151855]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000067252
AA Change: T2537A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000089777
Gene: ENSMUSG00000014444
AA Change: T2537A

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 156 169 N/A INTRINSIC
transmembrane domain 211 233 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 316 333 N/A INTRINSIC
low complexity region 353 368 N/A INTRINSIC
low complexity region 396 408 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
transmembrane domain 513 535 N/A INTRINSIC
internal_repeat_1 541 658 5.31e-5 PROSPERO
transmembrane domain 685 707 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
transmembrane domain 817 839 N/A INTRINSIC
transmembrane domain 844 866 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
transmembrane domain 979 1001 N/A INTRINSIC
transmembrane domain 1005 1022 N/A INTRINSIC
transmembrane domain 1035 1057 N/A INTRINSIC
transmembrane domain 1154 1171 N/A INTRINSIC
transmembrane domain 1178 1197 N/A INTRINSIC
Pfam:PIEZO 1229 1458 1.1e-97 PFAM
low complexity region 1475 1486 N/A INTRINSIC
internal_repeat_1 1646 1752 5.31e-5 PROSPERO
low complexity region 1905 1921 N/A INTRINSIC
transmembrane domain 1976 1998 N/A INTRINSIC
transmembrane domain 2018 2038 N/A INTRINSIC
transmembrane domain 2045 2067 N/A INTRINSIC
transmembrane domain 2077 2094 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2126 2544 3.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116412
SMART Domains Protein: ENSMUSP00000112113
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 1e-3 SMART
Pfam:CTU2 347 470 2.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128383
SMART Domains Protein: ENSMUSP00000116194
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
transmembrane domain 247 269 N/A INTRINSIC
low complexity region 300 315 N/A INTRINSIC
transmembrane domain 379 401 N/A INTRINSIC
transmembrane domain 406 428 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
transmembrane domain 541 563 N/A INTRINSIC
transmembrane domain 567 584 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
transmembrane domain 716 733 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
transmembrane domain 774 796 N/A INTRINSIC
transmembrane domain 803 820 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
coiled coil region 895 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134127
SMART Domains Protein: ENSMUSP00000119237
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
SCOP:d1sur__ 25 128 4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136253
Predicted Effect unknown
Transcript: ENSMUST00000156333
AA Change: T2538A
SMART Domains Protein: ENSMUSP00000114584
Gene: ENSMUSG00000014444
AA Change: T2538A

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
transmembrane domain 317 334 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 397 409 N/A INTRINSIC
transmembrane domain 434 456 N/A INTRINSIC
transmembrane domain 469 491 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
internal_repeat_1 542 659 4.88e-5 PROSPERO
transmembrane domain 686 708 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
transmembrane domain 845 867 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
transmembrane domain 980 1002 N/A INTRINSIC
transmembrane domain 1006 1023 N/A INTRINSIC
transmembrane domain 1036 1058 N/A INTRINSIC
transmembrane domain 1155 1172 N/A INTRINSIC
transmembrane domain 1179 1198 N/A INTRINSIC
Pfam:PIEZO 1230 1459 2.3e-94 PFAM
low complexity region 1476 1487 N/A INTRINSIC
internal_repeat_1 1647 1753 4.88e-5 PROSPERO
low complexity region 1906 1922 N/A INTRINSIC
transmembrane domain 1977 1999 N/A INTRINSIC
transmembrane domain 2019 2039 N/A INTRINSIC
transmembrane domain 2046 2068 N/A INTRINSIC
transmembrane domain 2078 2095 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2127 2545 8.7e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146634
SMART Domains Protein: ENSMUSP00000119931
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 78 87 N/A INTRINSIC
low complexity region 96 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148497
SMART Domains Protein: ENSMUSP00000121725
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
low complexity region 288 300 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 505 522 N/A INTRINSIC
transmembrane domain 529 548 N/A INTRINSIC
Pfam:PIEZO 580 809 3.2e-98 PFAM
low complexity region 826 837 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151855
SMART Domains Protein: ENSMUSP00000133622
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 9e-4 SMART
Pfam:DUF2392 277 377 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212499
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mechanically-activated ion channel that links mechanical forces to biological signals. The encoded protein contains 36 transmembrane domains and functions as a homotetramer. Defects in this gene have been associated with dehydrated hereditary stomatocytosis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Most mice homozygous for a gene trapped allele die at midgestation, exhibiting embryonic growth retardation, pericardial effusion, and vascular remodeling defects in the yolk sac and the embryo proper. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,536,032 (GRCm39) H720L probably benign Het
Abca15 T C 7: 119,987,388 (GRCm39) Y1225H probably benign Het
Adck1 C A 12: 88,335,193 (GRCm39) N26K probably benign Het
Adcy3 A G 12: 4,245,208 (GRCm39) D382G probably damaging Het
Ahi1 T A 10: 20,876,488 (GRCm39) C800S probably benign Het
Ahnak G T 19: 8,992,287 (GRCm39) V4524L probably benign Het
Aoc1l1 C A 6: 48,952,890 (GRCm39) R272S probably benign Het
Apol11a C T 15: 77,397,778 (GRCm39) A43V probably benign Het
Arid1a T C 4: 133,421,214 (GRCm39) M479V unknown Het
Atp13a2 T A 4: 140,724,056 (GRCm39) C324S probably damaging Het
C2cd2 T G 16: 97,677,486 (GRCm39) T413P probably damaging Het
Cct5 A C 15: 31,591,107 (GRCm39) D531E Het
Chst1 A T 2: 92,444,523 (GRCm39) I332F probably damaging Het
Col12a1 A T 9: 79,527,344 (GRCm39) V2662D probably benign Het
Cts3 A G 13: 61,712,800 (GRCm39) Y307H probably benign Het
D630023F18Rik G A 1: 65,160,371 (GRCm39) probably benign Het
Dhx9 A G 1: 153,336,826 (GRCm39) I807T probably damaging Het
Exoc3l4 T C 12: 111,388,586 (GRCm39) L25P probably benign Het
Ggcx T A 6: 72,402,905 (GRCm39) C288S probably benign Het
Gjb3 A G 4: 127,220,140 (GRCm39) Y131H probably damaging Het
Hdhd3 A G 4: 62,417,574 (GRCm39) S201P probably benign Het
Helz2 A T 2: 180,881,848 (GRCm39) V315E probably damaging Het
Hsp90aa1 A G 12: 110,662,684 (GRCm39) probably null Het
Ift70a1 A T 2: 75,810,423 (GRCm39) Y553* probably null Het
Il12a C T 3: 68,598,875 (GRCm39) R19W unknown Het
Isoc1 C T 18: 58,806,347 (GRCm39) A219V possibly damaging Het
Jup T A 11: 100,269,124 (GRCm39) T430S probably benign Het
Klra5 C T 6: 129,886,911 (GRCm39) C39Y probably benign Het
Map4 A T 9: 109,855,268 (GRCm39) Q131L probably damaging Het
Mau2 T A 8: 70,480,165 (GRCm39) K314M probably damaging Het
Mga A G 2: 119,794,493 (GRCm39) M2726V probably benign Het
Mgme1 G A 2: 144,114,405 (GRCm39) probably null Het
Msrb2 A G 2: 19,399,066 (GRCm39) E143G probably benign Het
Muc5b G T 7: 141,411,350 (GRCm39) C1432F unknown Het
Naglu T C 11: 100,961,940 (GRCm39) Y138H probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nlrp1b A G 11: 71,109,193 (GRCm39) Y103H probably benign Het
Nodal A G 10: 61,259,459 (GRCm39) N299D probably damaging Het
Notch1 T C 2: 26,349,587 (GRCm39) T2518A probably benign Het
Nr2e1 A C 10: 42,448,948 (GRCm39) S97A probably benign Het
Nuak1 A T 10: 84,210,587 (GRCm39) S500R probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Nyap1 T C 5: 137,736,175 (GRCm39) E104G probably benign Het
Or3a1b C T 11: 74,012,526 (GRCm39) T137I probably benign Het
Or52e18 T A 7: 104,609,204 (GRCm39) H245L probably damaging Het
Palld T C 8: 62,330,107 (GRCm39) T257A probably benign Het
Pcnx4 C T 12: 72,603,043 (GRCm39) P435L probably damaging Het
Plagl1 T C 10: 13,003,872 (GRCm39) L380P unknown Het
Polrmt G T 10: 79,576,415 (GRCm39) Q514K probably benign Het
Psg17 T G 7: 18,553,851 (GRCm39) D133A probably benign Het
Rab3b G A 4: 108,797,903 (GRCm39) D185N probably benign Het
Ranbp2 T A 10: 58,291,736 (GRCm39) S248T probably benign Het
Rdh10 C A 1: 16,199,430 (GRCm39) A212D probably damaging Het
Rinl A G 7: 28,495,089 (GRCm39) H154R Het
Selenbp1 T C 3: 94,851,414 (GRCm39) M389T probably benign Het
Serpina1c T A 12: 103,862,400 (GRCm39) H305L possibly damaging Het
Sh3rf2 T A 18: 42,282,746 (GRCm39) S467T Het
Sipa1l1 A G 12: 82,443,335 (GRCm39) D875G probably benign Het
Slc10a6 A T 5: 103,776,800 (GRCm39) V100D probably damaging Het
Slc13a4 T C 6: 35,247,290 (GRCm39) I577V possibly damaging Het
Slc20a2 T C 8: 23,030,447 (GRCm39) F168L probably benign Het
Slc25a1 A T 16: 17,745,108 (GRCm39) probably null Het
Slc5a12 A G 2: 110,471,242 (GRCm39) S495G probably benign Het
Smpdl3a A G 10: 57,677,028 (GRCm39) D42G possibly damaging Het
Spag16 G C 1: 70,420,459 (GRCm39) L482F probably damaging Het
Susd5 G A 9: 113,925,289 (GRCm39) G391R probably damaging Het
Sync G T 4: 129,187,618 (GRCm39) A217S Het
Tha1 T A 11: 117,759,512 (GRCm39) N326Y probably damaging Het
Tjp1 A T 7: 64,952,564 (GRCm39) F1590Y probably benign Het
Tle4 T C 19: 14,445,583 (GRCm39) N221S probably benign Het
Tln1 T C 4: 43,536,024 (GRCm39) T2054A probably damaging Het
Ttll4 A G 1: 74,718,949 (GRCm39) K267E probably benign Het
Usp32 C T 11: 84,913,118 (GRCm39) G930D probably damaging Het
Vmn2r75 T C 7: 85,813,447 (GRCm39) N452D probably damaging Het
Vmn2r81 T C 10: 79,104,028 (GRCm39) L217P possibly damaging Het
Wnt2 T A 6: 18,030,397 (GRCm39) probably benign Het
Zfp459 C T 13: 67,556,735 (GRCm39) S116N probably benign Het
Zfp981 C A 4: 146,622,410 (GRCm39) T445N possibly damaging Het
Other mutations in Piezo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Piezo1 APN 8 123,224,609 (GRCm39) missense possibly damaging 0.91
IGL01094:Piezo1 APN 8 123,208,877 (GRCm39) missense probably damaging 0.99
IGL01321:Piezo1 APN 8 123,214,339 (GRCm39) missense probably damaging 0.99
IGL01695:Piezo1 APN 8 123,222,248 (GRCm39) missense possibly damaging 0.81
IGL01762:Piezo1 APN 8 123,214,668 (GRCm39) nonsense probably null
IGL01922:Piezo1 APN 8 123,219,431 (GRCm39) missense probably benign 0.41
IGL01953:Piezo1 APN 8 123,217,923 (GRCm39) missense probably damaging 1.00
IGL01997:Piezo1 APN 8 123,215,070 (GRCm39) splice site probably benign
IGL02381:Piezo1 APN 8 123,225,283 (GRCm39) missense probably benign 0.28
IGL02398:Piezo1 APN 8 123,213,302 (GRCm39) missense probably benign 0.21
IGL02562:Piezo1 APN 8 123,223,502 (GRCm39) missense probably benign 0.11
IGL02572:Piezo1 APN 8 123,212,044 (GRCm39) missense probably benign 0.28
IGL02691:Piezo1 APN 8 123,228,688 (GRCm39) missense possibly damaging 0.58
IGL02726:Piezo1 APN 8 123,213,894 (GRCm39) missense probably damaging 0.99
IGL02814:Piezo1 APN 8 123,224,954 (GRCm39) missense probably damaging 1.00
IGL02931:Piezo1 APN 8 123,210,258 (GRCm39) missense probably damaging 1.00
IGL03145:Piezo1 APN 8 123,209,660 (GRCm39) missense probably benign 0.14
FR4449:Piezo1 UTSW 8 123,222,308 (GRCm39) missense probably damaging 1.00
FR4548:Piezo1 UTSW 8 123,222,308 (GRCm39) missense probably damaging 1.00
FR4737:Piezo1 UTSW 8 123,222,308 (GRCm39) missense probably damaging 1.00
FR4976:Piezo1 UTSW 8 123,222,308 (GRCm39) missense probably damaging 1.00
LCD18:Piezo1 UTSW 8 123,222,308 (GRCm39) missense probably damaging 1.00
R0085:Piezo1 UTSW 8 123,228,354 (GRCm39) missense probably damaging 0.98
R0096:Piezo1 UTSW 8 123,212,109 (GRCm39) unclassified probably benign
R0970:Piezo1 UTSW 8 123,213,549 (GRCm39) missense possibly damaging 0.94
R1364:Piezo1 UTSW 8 123,225,310 (GRCm39) missense possibly damaging 0.61
R1460:Piezo1 UTSW 8 123,228,890 (GRCm39) missense possibly damaging 0.86
R1485:Piezo1 UTSW 8 123,208,788 (GRCm39) missense probably damaging 1.00
R1538:Piezo1 UTSW 8 123,218,142 (GRCm39) missense probably damaging 1.00
R1655:Piezo1 UTSW 8 123,223,561 (GRCm39) missense probably benign 0.09
R1700:Piezo1 UTSW 8 123,214,241 (GRCm39) missense probably damaging 1.00
R1860:Piezo1 UTSW 8 123,222,489 (GRCm39) missense possibly damaging 0.90
R1861:Piezo1 UTSW 8 123,222,489 (GRCm39) missense possibly damaging 0.90
R1899:Piezo1 UTSW 8 123,216,305 (GRCm39) missense probably damaging 1.00
R1899:Piezo1 UTSW 8 123,209,384 (GRCm39) unclassified probably benign
R1900:Piezo1 UTSW 8 123,209,384 (GRCm39) unclassified probably benign
R2018:Piezo1 UTSW 8 123,209,451 (GRCm39) missense probably benign 0.43
R2019:Piezo1 UTSW 8 123,209,451 (GRCm39) missense probably benign 0.43
R2219:Piezo1 UTSW 8 123,218,227 (GRCm39) missense probably benign 0.01
R2331:Piezo1 UTSW 8 123,214,005 (GRCm39) splice site probably null
R3016:Piezo1 UTSW 8 123,232,766 (GRCm39) critical splice donor site probably null
R3699:Piezo1 UTSW 8 123,221,642 (GRCm39) missense probably damaging 1.00
R3700:Piezo1 UTSW 8 123,221,642 (GRCm39) missense probably damaging 1.00
R3746:Piezo1 UTSW 8 123,219,377 (GRCm39) missense probably damaging 1.00
R3905:Piezo1 UTSW 8 123,208,882 (GRCm39) missense probably damaging 1.00
R4093:Piezo1 UTSW 8 123,227,899 (GRCm39) critical splice donor site probably null
R4296:Piezo1 UTSW 8 123,217,866 (GRCm39) missense probably damaging 1.00
R4396:Piezo1 UTSW 8 123,225,413 (GRCm39) missense probably damaging 0.98
R4467:Piezo1 UTSW 8 123,213,135 (GRCm39) missense probably benign 0.17
R4614:Piezo1 UTSW 8 123,213,150 (GRCm39) missense probably benign 0.25
R4642:Piezo1 UTSW 8 123,222,193 (GRCm39) missense probably damaging 1.00
R4688:Piezo1 UTSW 8 123,215,278 (GRCm39) missense probably damaging 1.00
R4734:Piezo1 UTSW 8 123,224,945 (GRCm39) missense probably damaging 1.00
R4749:Piezo1 UTSW 8 123,224,945 (GRCm39) missense probably damaging 1.00
R4749:Piezo1 UTSW 8 123,213,678 (GRCm39) missense possibly damaging 0.48
R4865:Piezo1 UTSW 8 123,213,660 (GRCm39) missense probably damaging 1.00
R4869:Piezo1 UTSW 8 123,214,284 (GRCm39) missense probably benign
R4962:Piezo1 UTSW 8 123,213,220 (GRCm39) missense probably benign 0.41
R5026:Piezo1 UTSW 8 123,213,557 (GRCm39) missense probably benign 0.11
R5418:Piezo1 UTSW 8 123,213,519 (GRCm39) missense probably damaging 1.00
R5625:Piezo1 UTSW 8 123,209,699 (GRCm39) missense probably benign 0.01
R5759:Piezo1 UTSW 8 123,234,394 (GRCm39) missense probably damaging 0.98
R5864:Piezo1 UTSW 8 123,213,112 (GRCm39) missense possibly damaging 0.75
R5898:Piezo1 UTSW 8 123,214,682 (GRCm39) missense probably benign 0.00
R5948:Piezo1 UTSW 8 123,210,086 (GRCm39) missense probably benign 0.01
R6052:Piezo1 UTSW 8 123,233,008 (GRCm39) missense probably damaging 1.00
R6086:Piezo1 UTSW 8 123,228,396 (GRCm39) missense possibly damaging 0.73
R6216:Piezo1 UTSW 8 123,215,869 (GRCm39) missense probably benign 0.05
R6271:Piezo1 UTSW 8 123,221,671 (GRCm39) missense probably damaging 1.00
R6549:Piezo1 UTSW 8 123,227,002 (GRCm39) missense
R6723:Piezo1 UTSW 8 123,234,366 (GRCm39) missense probably benign 0.15
R6871:Piezo1 UTSW 8 123,211,766 (GRCm39) splice site probably null
R6919:Piezo1 UTSW 8 123,217,020 (GRCm39) missense probably damaging 1.00
R7085:Piezo1 UTSW 8 123,217,633 (GRCm39) missense
R7105:Piezo1 UTSW 8 123,208,857 (GRCm39) missense unknown
R7267:Piezo1 UTSW 8 123,224,268 (GRCm39) missense
R7337:Piezo1 UTSW 8 123,212,463 (GRCm39) missense
R7381:Piezo1 UTSW 8 123,228,397 (GRCm39) missense
R7480:Piezo1 UTSW 8 123,225,234 (GRCm39) nonsense probably null
R7515:Piezo1 UTSW 8 123,212,035 (GRCm39) missense
R7571:Piezo1 UTSW 8 123,225,157 (GRCm39) missense
R7601:Piezo1 UTSW 8 123,210,220 (GRCm39) splice site probably null
R7827:Piezo1 UTSW 8 123,209,659 (GRCm39) missense probably damaging 0.96
R7923:Piezo1 UTSW 8 123,223,183 (GRCm39) missense
R7975:Piezo1 UTSW 8 123,222,504 (GRCm39) missense
R8071:Piezo1 UTSW 8 123,213,750 (GRCm39) missense probably null
R8231:Piezo1 UTSW 8 123,232,836 (GRCm39) missense
R8270:Piezo1 UTSW 8 123,228,298 (GRCm39) missense
R8784:Piezo1 UTSW 8 123,223,328 (GRCm39) splice site probably benign
R8788:Piezo1 UTSW 8 123,228,533 (GRCm39) missense
R8829:Piezo1 UTSW 8 123,217,753 (GRCm39) missense
R8890:Piezo1 UTSW 8 123,216,330 (GRCm39) missense
R8950:Piezo1 UTSW 8 123,208,729 (GRCm39) missense probably benign 0.01
R8994:Piezo1 UTSW 8 123,209,829 (GRCm39) missense unknown
R9036:Piezo1 UTSW 8 123,215,090 (GRCm39) missense
R9146:Piezo1 UTSW 8 123,227,002 (GRCm39) missense
R9251:Piezo1 UTSW 8 123,219,354 (GRCm39) missense
R9307:Piezo1 UTSW 8 123,213,832 (GRCm39) missense
R9375:Piezo1 UTSW 8 123,228,604 (GRCm39) missense
R9424:Piezo1 UTSW 8 123,218,079 (GRCm39) missense
R9578:Piezo1 UTSW 8 123,224,214 (GRCm39) missense
R9722:Piezo1 UTSW 8 123,225,497 (GRCm39) missense
R9775:Piezo1 UTSW 8 123,208,927 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCAGCATCATCAGGGCTTAC -3'
(R):5'- ACAGGATTGTGGGGCTGTAC -3'

Sequencing Primer
(F):5'- CATCATCAGGGCTTACGTAGG -3'
(R):5'- GGCTGTACGTCTCCATCGTG -3'
Posted On 2022-01-20