Incidental Mutation 'R9145:Plagl1'
ID 694577
Institutional Source Beutler Lab
Gene Symbol Plagl1
Ensembl Gene ENSMUSG00000019817
Gene Name pleiomorphic adenoma gene-like 1
Synonyms Zac1
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.408) question?
Stock # R9145 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 12966576-13007438 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13003872 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 380 (L380P)
Ref Sequence ENSEMBL: ENSMUSP00000112847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121325] [ENSMUST00000121646] [ENSMUST00000121766] [ENSMUST00000130313] [ENSMUST00000143582] [ENSMUST00000145103] [ENSMUST00000193426]
AlphaFold Q9JLQ4
Predicted Effect
SMART Domains Protein: ENSMUSP00000112889
Gene: ENSMUSG00000019817
AA Change: L380P

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121646
AA Change: L380P
SMART Domains Protein: ENSMUSP00000112847
Gene: ENSMUSG00000019817
AA Change: L380P

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121766
AA Change: L380P
SMART Domains Protein: ENSMUSP00000113710
Gene: ENSMUSG00000019817
AA Change: L380P

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130313
SMART Domains Protein: ENSMUSP00000117321
Gene: ENSMUSG00000019817

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143582
Predicted Effect probably benign
Transcript: ENSMUST00000145103
Predicted Effect probably benign
Transcript: ENSMUST00000193426
SMART Domains Protein: ENSMUSP00000141514
Gene: ENSMUSG00000019817

DomainStartEndE-ValueType
ZnF_C2H2 4 26 1e-4 SMART
ZnF_C2H2 32 56 3.2e-6 SMART
ZnF_C2H2 62 84 1.3e-5 SMART
ZnF_C2H2 91 113 1.1e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2 zinc finger protein that functions as a suppressor of cell growth. This gene is often deleted or methylated and silenced in cancer cells. In addition, overexpression of this gene during fetal development is thought to be the causal factor for transient neonatal diabetes mellitus (TNDM). Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding two different protein isoforms. The P1 downstream promoter of this gene is imprinted, with preferential expression from the paternal allele in many tissues. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice exhibit significantly reduced birth weights. Heterozygous mice with a paternal copy of the null allele show reduced fetal and birth weights, altered ossification, dyspnea and background-dependent neonatal lethality, as well as wrinkled skin and curly tails with 30% penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,536,032 (GRCm39) H720L probably benign Het
Abca15 T C 7: 119,987,388 (GRCm39) Y1225H probably benign Het
Adck1 C A 12: 88,335,193 (GRCm39) N26K probably benign Het
Adcy3 A G 12: 4,245,208 (GRCm39) D382G probably damaging Het
Ahi1 T A 10: 20,876,488 (GRCm39) C800S probably benign Het
Ahnak G T 19: 8,992,287 (GRCm39) V4524L probably benign Het
Aoc1l1 C A 6: 48,952,890 (GRCm39) R272S probably benign Het
Apol11a C T 15: 77,397,778 (GRCm39) A43V probably benign Het
Arid1a T C 4: 133,421,214 (GRCm39) M479V unknown Het
Atp13a2 T A 4: 140,724,056 (GRCm39) C324S probably damaging Het
C2cd2 T G 16: 97,677,486 (GRCm39) T413P probably damaging Het
Cct5 A C 15: 31,591,107 (GRCm39) D531E Het
Chst1 A T 2: 92,444,523 (GRCm39) I332F probably damaging Het
Col12a1 A T 9: 79,527,344 (GRCm39) V2662D probably benign Het
Cts3 A G 13: 61,712,800 (GRCm39) Y307H probably benign Het
D630023F18Rik G A 1: 65,160,371 (GRCm39) probably benign Het
Dhx9 A G 1: 153,336,826 (GRCm39) I807T probably damaging Het
Exoc3l4 T C 12: 111,388,586 (GRCm39) L25P probably benign Het
Ggcx T A 6: 72,402,905 (GRCm39) C288S probably benign Het
Gjb3 A G 4: 127,220,140 (GRCm39) Y131H probably damaging Het
Hdhd3 A G 4: 62,417,574 (GRCm39) S201P probably benign Het
Helz2 A T 2: 180,881,848 (GRCm39) V315E probably damaging Het
Hsp90aa1 A G 12: 110,662,684 (GRCm39) probably null Het
Ift70a1 A T 2: 75,810,423 (GRCm39) Y553* probably null Het
Il12a C T 3: 68,598,875 (GRCm39) R19W unknown Het
Isoc1 C T 18: 58,806,347 (GRCm39) A219V possibly damaging Het
Jup T A 11: 100,269,124 (GRCm39) T430S probably benign Het
Klra5 C T 6: 129,886,911 (GRCm39) C39Y probably benign Het
Map4 A T 9: 109,855,268 (GRCm39) Q131L probably damaging Het
Mau2 T A 8: 70,480,165 (GRCm39) K314M probably damaging Het
Mga A G 2: 119,794,493 (GRCm39) M2726V probably benign Het
Mgme1 G A 2: 144,114,405 (GRCm39) probably null Het
Msrb2 A G 2: 19,399,066 (GRCm39) E143G probably benign Het
Muc5b G T 7: 141,411,350 (GRCm39) C1432F unknown Het
Naglu T C 11: 100,961,940 (GRCm39) Y138H probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nlrp1b A G 11: 71,109,193 (GRCm39) Y103H probably benign Het
Nodal A G 10: 61,259,459 (GRCm39) N299D probably damaging Het
Notch1 T C 2: 26,349,587 (GRCm39) T2518A probably benign Het
Nr2e1 A C 10: 42,448,948 (GRCm39) S97A probably benign Het
Nuak1 A T 10: 84,210,587 (GRCm39) S500R probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Nyap1 T C 5: 137,736,175 (GRCm39) E104G probably benign Het
Or3a1b C T 11: 74,012,526 (GRCm39) T137I probably benign Het
Or52e18 T A 7: 104,609,204 (GRCm39) H245L probably damaging Het
Palld T C 8: 62,330,107 (GRCm39) T257A probably benign Het
Pcnx4 C T 12: 72,603,043 (GRCm39) P435L probably damaging Het
Piezo1 T C 8: 123,208,753 (GRCm39) T2538A unknown Het
Polrmt G T 10: 79,576,415 (GRCm39) Q514K probably benign Het
Psg17 T G 7: 18,553,851 (GRCm39) D133A probably benign Het
Rab3b G A 4: 108,797,903 (GRCm39) D185N probably benign Het
Ranbp2 T A 10: 58,291,736 (GRCm39) S248T probably benign Het
Rdh10 C A 1: 16,199,430 (GRCm39) A212D probably damaging Het
Rinl A G 7: 28,495,089 (GRCm39) H154R Het
Selenbp1 T C 3: 94,851,414 (GRCm39) M389T probably benign Het
Serpina1c T A 12: 103,862,400 (GRCm39) H305L possibly damaging Het
Sh3rf2 T A 18: 42,282,746 (GRCm39) S467T Het
Sipa1l1 A G 12: 82,443,335 (GRCm39) D875G probably benign Het
Slc10a6 A T 5: 103,776,800 (GRCm39) V100D probably damaging Het
Slc13a4 T C 6: 35,247,290 (GRCm39) I577V possibly damaging Het
Slc20a2 T C 8: 23,030,447 (GRCm39) F168L probably benign Het
Slc25a1 A T 16: 17,745,108 (GRCm39) probably null Het
Slc5a12 A G 2: 110,471,242 (GRCm39) S495G probably benign Het
Smpdl3a A G 10: 57,677,028 (GRCm39) D42G possibly damaging Het
Spag16 G C 1: 70,420,459 (GRCm39) L482F probably damaging Het
Susd5 G A 9: 113,925,289 (GRCm39) G391R probably damaging Het
Sync G T 4: 129,187,618 (GRCm39) A217S Het
Tha1 T A 11: 117,759,512 (GRCm39) N326Y probably damaging Het
Tjp1 A T 7: 64,952,564 (GRCm39) F1590Y probably benign Het
Tle4 T C 19: 14,445,583 (GRCm39) N221S probably benign Het
Tln1 T C 4: 43,536,024 (GRCm39) T2054A probably damaging Het
Ttll4 A G 1: 74,718,949 (GRCm39) K267E probably benign Het
Usp32 C T 11: 84,913,118 (GRCm39) G930D probably damaging Het
Vmn2r75 T C 7: 85,813,447 (GRCm39) N452D probably damaging Het
Vmn2r81 T C 10: 79,104,028 (GRCm39) L217P possibly damaging Het
Wnt2 T A 6: 18,030,397 (GRCm39) probably benign Het
Zfp459 C T 13: 67,556,735 (GRCm39) S116N probably benign Het
Zfp981 C A 4: 146,622,410 (GRCm39) T445N possibly damaging Het
Other mutations in Plagl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Plagl1 APN 10 13,003,616 (GRCm39) unclassified probably benign
R0554:Plagl1 UTSW 10 13,002,926 (GRCm39) missense probably benign 0.07
R0842:Plagl1 UTSW 10 13,004,298 (GRCm39) unclassified probably benign
R0967:Plagl1 UTSW 10 13,003,986 (GRCm39) unclassified probably benign
R1610:Plagl1 UTSW 10 13,004,706 (GRCm39) unclassified probably benign
R2002:Plagl1 UTSW 10 13,004,402 (GRCm39) unclassified probably benign
R2107:Plagl1 UTSW 10 13,004,391 (GRCm39) unclassified probably benign
R2108:Plagl1 UTSW 10 13,004,391 (GRCm39) unclassified probably benign
R2191:Plagl1 UTSW 10 13,004,685 (GRCm39) unclassified probably benign
R4061:Plagl1 UTSW 10 13,004,515 (GRCm39) unclassified probably benign
R4062:Plagl1 UTSW 10 13,004,515 (GRCm39) unclassified probably benign
R4631:Plagl1 UTSW 10 13,003,743 (GRCm39) unclassified probably benign
R4924:Plagl1 UTSW 10 13,003,301 (GRCm39) missense possibly damaging 0.85
R5071:Plagl1 UTSW 10 13,003,005 (GRCm39) missense probably damaging 1.00
R5138:Plagl1 UTSW 10 13,003,919 (GRCm39) unclassified probably benign
R5893:Plagl1 UTSW 10 13,003,938 (GRCm39) unclassified probably benign
R5971:Plagl1 UTSW 10 13,003,490 (GRCm39) missense probably damaging 1.00
R6061:Plagl1 UTSW 10 13,003,639 (GRCm39) unclassified probably benign
R6138:Plagl1 UTSW 10 13,003,490 (GRCm39) missense probably damaging 1.00
R6170:Plagl1 UTSW 10 13,002,975 (GRCm39) missense probably damaging 1.00
R6625:Plagl1 UTSW 10 13,003,806 (GRCm39) unclassified probably benign
R6970:Plagl1 UTSW 10 13,000,860 (GRCm39) missense probably damaging 1.00
R7035:Plagl1 UTSW 10 13,003,977 (GRCm39) unclassified probably benign
R8265:Plagl1 UTSW 10 13,004,625 (GRCm39) missense unknown
R9668:Plagl1 UTSW 10 13,004,466 (GRCm39) missense unknown
R9676:Plagl1 UTSW 10 13,003,955 (GRCm39) missense unknown
U15987:Plagl1 UTSW 10 13,003,490 (GRCm39) missense probably damaging 1.00
Z1176:Plagl1 UTSW 10 13,004,460 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGCCTTTAGAGCCTTTGGAGC -3'
(R):5'- ACATGGGTTGAACTTGAGAGGC -3'

Sequencing Primer
(F):5'- AGAGCCTTTGGAGCCTCTG -3'
(R):5'- GGCTCTTGCAGAGGAAATTCC -3'
Posted On 2022-01-20