Incidental Mutation 'R9145:Ahi1'
ID 694578
Institutional Source Beutler Lab
Gene Symbol Ahi1
Ensembl Gene ENSMUSG00000019986
Gene Name Abelson helper integration site 1
Synonyms Jouberin, Ahi-1, D10Bwg0629e, 1700015F03Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.866) question?
Stock # R9145 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 20828446-20956328 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20876488 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 800 (C800S)
Ref Sequence ENSEMBL: ENSMUSP00000101164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105525] [ENSMUST00000213104]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000105525
AA Change: C800S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000101164
Gene: ENSMUSG00000019986
AA Change: C800S

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 85 106 N/A INTRINSIC
low complexity region 148 159 N/A INTRINSIC
WD40 448 490 4.3e-1 SMART
WD40 493 532 9.3e-9 SMART
WD40 537 576 2.48e-4 SMART
WD40 583 622 6.09e-4 SMART
WD40 641 678 1.9e2 SMART
WD40 684 721 3.98e0 SMART
WD40 724 769 9.51e1 SMART
SH3 905 961 2.15e-21 SMART
low complexity region 975 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213104
AA Change: C800S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is apparently required for both cerebellar and cortical development in humans. This gene mutations cause specific forms of Joubert syndrome-related disorders. Joubert syndrome (JS) is a recessively inherited developmental brain disorder with several identified causative chromosomal loci. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mouse embryonic fibroblasts homozygous for one knock-out allele exhibit reduced and abnormal cilia. Mice homozygous for another knock-out allele exhibit premature death and abnormal kidney morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,536,032 (GRCm39) H720L probably benign Het
Abca15 T C 7: 119,987,388 (GRCm39) Y1225H probably benign Het
Adck1 C A 12: 88,335,193 (GRCm39) N26K probably benign Het
Adcy3 A G 12: 4,245,208 (GRCm39) D382G probably damaging Het
Ahnak G T 19: 8,992,287 (GRCm39) V4524L probably benign Het
Aoc1l1 C A 6: 48,952,890 (GRCm39) R272S probably benign Het
Apol11a C T 15: 77,397,778 (GRCm39) A43V probably benign Het
Arid1a T C 4: 133,421,214 (GRCm39) M479V unknown Het
Atp13a2 T A 4: 140,724,056 (GRCm39) C324S probably damaging Het
C2cd2 T G 16: 97,677,486 (GRCm39) T413P probably damaging Het
Cct5 A C 15: 31,591,107 (GRCm39) D531E Het
Chst1 A T 2: 92,444,523 (GRCm39) I332F probably damaging Het
Col12a1 A T 9: 79,527,344 (GRCm39) V2662D probably benign Het
Cts3 A G 13: 61,712,800 (GRCm39) Y307H probably benign Het
D630023F18Rik G A 1: 65,160,371 (GRCm39) probably benign Het
Dhx9 A G 1: 153,336,826 (GRCm39) I807T probably damaging Het
Exoc3l4 T C 12: 111,388,586 (GRCm39) L25P probably benign Het
Ggcx T A 6: 72,402,905 (GRCm39) C288S probably benign Het
Gjb3 A G 4: 127,220,140 (GRCm39) Y131H probably damaging Het
Hdhd3 A G 4: 62,417,574 (GRCm39) S201P probably benign Het
Helz2 A T 2: 180,881,848 (GRCm39) V315E probably damaging Het
Hsp90aa1 A G 12: 110,662,684 (GRCm39) probably null Het
Ift70a1 A T 2: 75,810,423 (GRCm39) Y553* probably null Het
Il12a C T 3: 68,598,875 (GRCm39) R19W unknown Het
Isoc1 C T 18: 58,806,347 (GRCm39) A219V possibly damaging Het
Jup T A 11: 100,269,124 (GRCm39) T430S probably benign Het
Klra5 C T 6: 129,886,911 (GRCm39) C39Y probably benign Het
Map4 A T 9: 109,855,268 (GRCm39) Q131L probably damaging Het
Mau2 T A 8: 70,480,165 (GRCm39) K314M probably damaging Het
Mga A G 2: 119,794,493 (GRCm39) M2726V probably benign Het
Mgme1 G A 2: 144,114,405 (GRCm39) probably null Het
Msrb2 A G 2: 19,399,066 (GRCm39) E143G probably benign Het
Muc5b G T 7: 141,411,350 (GRCm39) C1432F unknown Het
Naglu T C 11: 100,961,940 (GRCm39) Y138H probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nlrp1b A G 11: 71,109,193 (GRCm39) Y103H probably benign Het
Nodal A G 10: 61,259,459 (GRCm39) N299D probably damaging Het
Notch1 T C 2: 26,349,587 (GRCm39) T2518A probably benign Het
Nr2e1 A C 10: 42,448,948 (GRCm39) S97A probably benign Het
Nuak1 A T 10: 84,210,587 (GRCm39) S500R probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Nyap1 T C 5: 137,736,175 (GRCm39) E104G probably benign Het
Or3a1b C T 11: 74,012,526 (GRCm39) T137I probably benign Het
Or52e18 T A 7: 104,609,204 (GRCm39) H245L probably damaging Het
Palld T C 8: 62,330,107 (GRCm39) T257A probably benign Het
Pcnx4 C T 12: 72,603,043 (GRCm39) P435L probably damaging Het
Piezo1 T C 8: 123,208,753 (GRCm39) T2538A unknown Het
Plagl1 T C 10: 13,003,872 (GRCm39) L380P unknown Het
Polrmt G T 10: 79,576,415 (GRCm39) Q514K probably benign Het
Psg17 T G 7: 18,553,851 (GRCm39) D133A probably benign Het
Rab3b G A 4: 108,797,903 (GRCm39) D185N probably benign Het
Ranbp2 T A 10: 58,291,736 (GRCm39) S248T probably benign Het
Rdh10 C A 1: 16,199,430 (GRCm39) A212D probably damaging Het
Rinl A G 7: 28,495,089 (GRCm39) H154R Het
Selenbp1 T C 3: 94,851,414 (GRCm39) M389T probably benign Het
Serpina1c T A 12: 103,862,400 (GRCm39) H305L possibly damaging Het
Sh3rf2 T A 18: 42,282,746 (GRCm39) S467T Het
Sipa1l1 A G 12: 82,443,335 (GRCm39) D875G probably benign Het
Slc10a6 A T 5: 103,776,800 (GRCm39) V100D probably damaging Het
Slc13a4 T C 6: 35,247,290 (GRCm39) I577V possibly damaging Het
Slc20a2 T C 8: 23,030,447 (GRCm39) F168L probably benign Het
Slc25a1 A T 16: 17,745,108 (GRCm39) probably null Het
Slc5a12 A G 2: 110,471,242 (GRCm39) S495G probably benign Het
Smpdl3a A G 10: 57,677,028 (GRCm39) D42G possibly damaging Het
Spag16 G C 1: 70,420,459 (GRCm39) L482F probably damaging Het
Susd5 G A 9: 113,925,289 (GRCm39) G391R probably damaging Het
Sync G T 4: 129,187,618 (GRCm39) A217S Het
Tha1 T A 11: 117,759,512 (GRCm39) N326Y probably damaging Het
Tjp1 A T 7: 64,952,564 (GRCm39) F1590Y probably benign Het
Tle4 T C 19: 14,445,583 (GRCm39) N221S probably benign Het
Tln1 T C 4: 43,536,024 (GRCm39) T2054A probably damaging Het
Ttll4 A G 1: 74,718,949 (GRCm39) K267E probably benign Het
Usp32 C T 11: 84,913,118 (GRCm39) G930D probably damaging Het
Vmn2r75 T C 7: 85,813,447 (GRCm39) N452D probably damaging Het
Vmn2r81 T C 10: 79,104,028 (GRCm39) L217P possibly damaging Het
Wnt2 T A 6: 18,030,397 (GRCm39) probably benign Het
Zfp459 C T 13: 67,556,735 (GRCm39) S116N probably benign Het
Zfp981 C A 4: 146,622,410 (GRCm39) T445N possibly damaging Het
Other mutations in Ahi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ahi1 APN 10 20,848,040 (GRCm39) missense probably damaging 1.00
IGL00914:Ahi1 APN 10 20,860,198 (GRCm39) splice site probably null
IGL01075:Ahi1 APN 10 20,862,924 (GRCm39) missense possibly damaging 0.80
IGL01094:Ahi1 APN 10 20,847,959 (GRCm39) missense probably damaging 0.99
IGL01128:Ahi1 APN 10 20,950,332 (GRCm39) missense probably benign
IGL01527:Ahi1 APN 10 20,835,984 (GRCm39) splice site probably benign
IGL01821:Ahi1 APN 10 20,917,142 (GRCm39) critical splice donor site probably null
IGL02159:Ahi1 APN 10 20,934,076 (GRCm39) missense probably benign 0.13
IGL02176:Ahi1 APN 10 20,846,815 (GRCm39) missense probably benign 0.00
IGL02200:Ahi1 APN 10 20,857,213 (GRCm39) splice site probably benign
IGL02232:Ahi1 APN 10 20,857,274 (GRCm39) missense probably damaging 1.00
IGL02305:Ahi1 APN 10 20,846,796 (GRCm39) missense probably benign 0.00
IGL02323:Ahi1 APN 10 20,847,933 (GRCm39) missense probably damaging 1.00
IGL02885:Ahi1 APN 10 20,931,012 (GRCm39) missense possibly damaging 0.61
IGL02958:Ahi1 APN 10 20,839,698 (GRCm39) missense probably damaging 1.00
IGL02971:Ahi1 APN 10 20,876,450 (GRCm39) missense possibly damaging 0.93
IGL03109:Ahi1 APN 10 20,846,841 (GRCm39) missense probably benign 0.00
IGL03192:Ahi1 APN 10 20,841,534 (GRCm39) missense probably benign 0.00
IGL03377:Ahi1 APN 10 20,893,903 (GRCm39) missense possibly damaging 0.51
arisen UTSW 10 20,883,667 (GRCm39) missense possibly damaging 0.53
urspringt UTSW 10 20,860,292 (GRCm39) missense probably damaging 1.00
P4717OSA:Ahi1 UTSW 10 20,848,009 (GRCm39) missense probably damaging 1.00
P4748:Ahi1 UTSW 10 20,848,009 (GRCm39) missense probably damaging 1.00
R0448:Ahi1 UTSW 10 20,847,974 (GRCm39) missense probably damaging 1.00
R0559:Ahi1 UTSW 10 20,876,618 (GRCm39) splice site probably benign
R0627:Ahi1 UTSW 10 20,841,421 (GRCm39) missense probably benign 0.10
R0652:Ahi1 UTSW 10 20,855,360 (GRCm39) missense probably damaging 1.00
R0690:Ahi1 UTSW 10 20,846,742 (GRCm39) splice site probably benign
R1209:Ahi1 UTSW 10 20,839,629 (GRCm39) missense probably damaging 0.98
R1364:Ahi1 UTSW 10 20,848,055 (GRCm39) missense probably damaging 0.97
R1510:Ahi1 UTSW 10 20,835,699 (GRCm39) missense probably benign 0.00
R1634:Ahi1 UTSW 10 20,841,592 (GRCm39) missense probably damaging 1.00
R1789:Ahi1 UTSW 10 20,839,014 (GRCm39) missense probably benign 0.18
R1818:Ahi1 UTSW 10 20,864,461 (GRCm39) missense probably damaging 1.00
R2069:Ahi1 UTSW 10 20,835,895 (GRCm39) missense probably damaging 0.98
R2148:Ahi1 UTSW 10 20,846,875 (GRCm39) missense possibly damaging 0.64
R2566:Ahi1 UTSW 10 20,846,810 (GRCm39) nonsense probably null
R2850:Ahi1 UTSW 10 20,876,492 (GRCm39) missense probably benign 0.07
R2862:Ahi1 UTSW 10 20,857,307 (GRCm39) missense probably damaging 0.99
R3969:Ahi1 UTSW 10 20,835,846 (GRCm39) missense probably damaging 1.00
R4430:Ahi1 UTSW 10 20,847,977 (GRCm39) missense probably damaging 1.00
R4496:Ahi1 UTSW 10 20,841,444 (GRCm39) missense probably benign 0.07
R4755:Ahi1 UTSW 10 20,930,946 (GRCm39) missense possibly damaging 0.94
R4916:Ahi1 UTSW 10 20,860,303 (GRCm39) missense probably damaging 1.00
R5216:Ahi1 UTSW 10 20,835,975 (GRCm39) missense probably benign 0.00
R5223:Ahi1 UTSW 10 20,846,818 (GRCm39) missense possibly damaging 0.79
R5224:Ahi1 UTSW 10 20,862,921 (GRCm39) missense probably damaging 1.00
R5604:Ahi1 UTSW 10 20,862,904 (GRCm39) missense probably damaging 1.00
R5665:Ahi1 UTSW 10 20,930,946 (GRCm39) missense possibly damaging 0.94
R5704:Ahi1 UTSW 10 20,950,326 (GRCm39) missense probably benign
R5769:Ahi1 UTSW 10 20,835,981 (GRCm39) critical splice donor site probably null
R5899:Ahi1 UTSW 10 20,876,465 (GRCm39) missense probably benign 0.06
R5936:Ahi1 UTSW 10 20,841,832 (GRCm39) missense probably damaging 1.00
R5969:Ahi1 UTSW 10 20,860,292 (GRCm39) missense probably damaging 1.00
R6066:Ahi1 UTSW 10 20,835,825 (GRCm39) missense possibly damaging 0.84
R6122:Ahi1 UTSW 10 20,934,064 (GRCm39) missense probably benign 0.26
R6135:Ahi1 UTSW 10 20,845,020 (GRCm39) missense probably benign 0.01
R6240:Ahi1 UTSW 10 20,852,980 (GRCm39) missense probably damaging 1.00
R6387:Ahi1 UTSW 10 20,844,942 (GRCm39) missense probably damaging 1.00
R6395:Ahi1 UTSW 10 20,855,491 (GRCm39) missense possibly damaging 0.49
R6406:Ahi1 UTSW 10 20,852,948 (GRCm39) missense probably damaging 1.00
R6440:Ahi1 UTSW 10 20,835,981 (GRCm39) critical splice donor site probably benign
R6558:Ahi1 UTSW 10 20,839,572 (GRCm39) missense probably damaging 1.00
R6744:Ahi1 UTSW 10 20,841,466 (GRCm39) missense probably damaging 1.00
R6755:Ahi1 UTSW 10 20,893,812 (GRCm39) missense probably damaging 0.98
R6927:Ahi1 UTSW 10 20,930,968 (GRCm39) missense probably damaging 1.00
R6932:Ahi1 UTSW 10 20,839,590 (GRCm39) missense probably benign 0.02
R6967:Ahi1 UTSW 10 20,864,524 (GRCm39) missense probably damaging 0.98
R7168:Ahi1 UTSW 10 20,893,831 (GRCm39) missense probably benign 0.01
R7169:Ahi1 UTSW 10 20,930,918 (GRCm39) missense probably damaging 1.00
R7327:Ahi1 UTSW 10 20,862,976 (GRCm39) missense probably damaging 0.99
R7351:Ahi1 UTSW 10 20,841,832 (GRCm39) missense probably damaging 1.00
R7489:Ahi1 UTSW 10 20,839,649 (GRCm39) missense probably benign 0.35
R7680:Ahi1 UTSW 10 20,883,667 (GRCm39) missense possibly damaging 0.53
R7878:Ahi1 UTSW 10 20,857,330 (GRCm39) critical splice donor site probably null
R7999:Ahi1 UTSW 10 20,841,580 (GRCm39) missense probably benign 0.31
R8219:Ahi1 UTSW 10 20,950,335 (GRCm39) missense probably benign 0.00
R8248:Ahi1 UTSW 10 20,847,991 (GRCm39) missense probably benign 0.04
R8560:Ahi1 UTSW 10 20,835,814 (GRCm39) missense probably benign 0.04
R8926:Ahi1 UTSW 10 20,930,982 (GRCm39) missense probably damaging 1.00
R8965:Ahi1 UTSW 10 20,839,761 (GRCm39) missense probably benign
R8987:Ahi1 UTSW 10 20,839,683 (GRCm39) missense probably damaging 1.00
R9013:Ahi1 UTSW 10 20,883,658 (GRCm39) missense probably benign 0.28
R9365:Ahi1 UTSW 10 20,848,035 (GRCm39) missense probably damaging 0.99
R9567:Ahi1 UTSW 10 20,857,300 (GRCm39) missense possibly damaging 0.95
X0024:Ahi1 UTSW 10 20,876,491 (GRCm39) missense possibly damaging 0.69
Z1177:Ahi1 UTSW 10 20,916,906 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- ATTTGCATTGCCTTCAAAGCTC -3'
(R):5'- TGGCTTCAAAACTAGTGCTTG -3'

Sequencing Primer
(F):5'- CTTACCAGTTATGTTGCCTATCAATG -3'
(R):5'- GGCTTCAAAACTAGTGCTTGAAAAG -3'
Posted On 2022-01-20