Incidental Mutation 'R9145:Nlrp1b'
ID 694586
Institutional Source Beutler Lab
Gene Symbol Nlrp1b
Ensembl Gene ENSMUSG00000070390
Gene Name NLR family, pyrin domain containing 1B
Synonyms Nalp1b
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9145 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 71043928-71121559 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71109193 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 103 (Y103H)
Ref Sequence ENSEMBL: ENSMUSP00000104156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094046] [ENSMUST00000108516] [ENSMUST00000136493]
AlphaFold A1Z198
Predicted Effect probably benign
Transcript: ENSMUST00000094046
AA Change: Y103H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091588
Gene: ENSMUSG00000070390
AA Change: Y103H

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.7e-43 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 812 1064 8.2e-104 PFAM
Pfam:CARD 1083 1166 3.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108516
AA Change: Y103H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104156
Gene: ENSMUSG00000070390
AA Change: Y103H

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.2e-42 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 811 1065 3.9e-136 PFAM
Pfam:CARD 1083 1166 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136493
AA Change: Y103H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121155
Gene: ENSMUSG00000070390
AA Change: Y103H

DomainStartEndE-ValueType
Pfam:NACHT 131 300 8.9e-43 PFAM
PDB:4IM6|A 610 662 6e-10 PDB
Blast:LRR 627 654 3e-11 BLAST
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ced-4 family of apoptosis proteins. Ced-family members contain a caspase recruitment domain (CARD) and are known to be key mediators of programmed cell death. The encoded protein contains a distinct N-terminal pyrin-like motif, which is possibly involved in protein-protein interactions. This protein interacts strongly with caspase 2 and weakly with caspase 9. Overexpression of this gene was demonstrated to induce apoptosis in cells. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection from anthrax lethal toxin-induced lung injury and pyroptosis of macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,536,032 (GRCm39) H720L probably benign Het
Abca15 T C 7: 119,987,388 (GRCm39) Y1225H probably benign Het
Adck1 C A 12: 88,335,193 (GRCm39) N26K probably benign Het
Adcy3 A G 12: 4,245,208 (GRCm39) D382G probably damaging Het
Ahi1 T A 10: 20,876,488 (GRCm39) C800S probably benign Het
Ahnak G T 19: 8,992,287 (GRCm39) V4524L probably benign Het
Aoc1l1 C A 6: 48,952,890 (GRCm39) R272S probably benign Het
Apol11a C T 15: 77,397,778 (GRCm39) A43V probably benign Het
Arid1a T C 4: 133,421,214 (GRCm39) M479V unknown Het
Atp13a2 T A 4: 140,724,056 (GRCm39) C324S probably damaging Het
C2cd2 T G 16: 97,677,486 (GRCm39) T413P probably damaging Het
Cct5 A C 15: 31,591,107 (GRCm39) D531E Het
Chst1 A T 2: 92,444,523 (GRCm39) I332F probably damaging Het
Col12a1 A T 9: 79,527,344 (GRCm39) V2662D probably benign Het
Cts3 A G 13: 61,712,800 (GRCm39) Y307H probably benign Het
D630023F18Rik G A 1: 65,160,371 (GRCm39) probably benign Het
Dhx9 A G 1: 153,336,826 (GRCm39) I807T probably damaging Het
Exoc3l4 T C 12: 111,388,586 (GRCm39) L25P probably benign Het
Ggcx T A 6: 72,402,905 (GRCm39) C288S probably benign Het
Gjb3 A G 4: 127,220,140 (GRCm39) Y131H probably damaging Het
Hdhd3 A G 4: 62,417,574 (GRCm39) S201P probably benign Het
Helz2 A T 2: 180,881,848 (GRCm39) V315E probably damaging Het
Hsp90aa1 A G 12: 110,662,684 (GRCm39) probably null Het
Ift70a1 A T 2: 75,810,423 (GRCm39) Y553* probably null Het
Il12a C T 3: 68,598,875 (GRCm39) R19W unknown Het
Isoc1 C T 18: 58,806,347 (GRCm39) A219V possibly damaging Het
Jup T A 11: 100,269,124 (GRCm39) T430S probably benign Het
Klra5 C T 6: 129,886,911 (GRCm39) C39Y probably benign Het
Map4 A T 9: 109,855,268 (GRCm39) Q131L probably damaging Het
Mau2 T A 8: 70,480,165 (GRCm39) K314M probably damaging Het
Mga A G 2: 119,794,493 (GRCm39) M2726V probably benign Het
Mgme1 G A 2: 144,114,405 (GRCm39) probably null Het
Msrb2 A G 2: 19,399,066 (GRCm39) E143G probably benign Het
Muc5b G T 7: 141,411,350 (GRCm39) C1432F unknown Het
Naglu T C 11: 100,961,940 (GRCm39) Y138H probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nodal A G 10: 61,259,459 (GRCm39) N299D probably damaging Het
Notch1 T C 2: 26,349,587 (GRCm39) T2518A probably benign Het
Nr2e1 A C 10: 42,448,948 (GRCm39) S97A probably benign Het
Nuak1 A T 10: 84,210,587 (GRCm39) S500R probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Nyap1 T C 5: 137,736,175 (GRCm39) E104G probably benign Het
Or3a1b C T 11: 74,012,526 (GRCm39) T137I probably benign Het
Or52e18 T A 7: 104,609,204 (GRCm39) H245L probably damaging Het
Palld T C 8: 62,330,107 (GRCm39) T257A probably benign Het
Pcnx4 C T 12: 72,603,043 (GRCm39) P435L probably damaging Het
Piezo1 T C 8: 123,208,753 (GRCm39) T2538A unknown Het
Plagl1 T C 10: 13,003,872 (GRCm39) L380P unknown Het
Polrmt G T 10: 79,576,415 (GRCm39) Q514K probably benign Het
Psg17 T G 7: 18,553,851 (GRCm39) D133A probably benign Het
Rab3b G A 4: 108,797,903 (GRCm39) D185N probably benign Het
Ranbp2 T A 10: 58,291,736 (GRCm39) S248T probably benign Het
Rdh10 C A 1: 16,199,430 (GRCm39) A212D probably damaging Het
Rinl A G 7: 28,495,089 (GRCm39) H154R Het
Selenbp1 T C 3: 94,851,414 (GRCm39) M389T probably benign Het
Serpina1c T A 12: 103,862,400 (GRCm39) H305L possibly damaging Het
Sh3rf2 T A 18: 42,282,746 (GRCm39) S467T Het
Sipa1l1 A G 12: 82,443,335 (GRCm39) D875G probably benign Het
Slc10a6 A T 5: 103,776,800 (GRCm39) V100D probably damaging Het
Slc13a4 T C 6: 35,247,290 (GRCm39) I577V possibly damaging Het
Slc20a2 T C 8: 23,030,447 (GRCm39) F168L probably benign Het
Slc25a1 A T 16: 17,745,108 (GRCm39) probably null Het
Slc5a12 A G 2: 110,471,242 (GRCm39) S495G probably benign Het
Smpdl3a A G 10: 57,677,028 (GRCm39) D42G possibly damaging Het
Spag16 G C 1: 70,420,459 (GRCm39) L482F probably damaging Het
Susd5 G A 9: 113,925,289 (GRCm39) G391R probably damaging Het
Sync G T 4: 129,187,618 (GRCm39) A217S Het
Tha1 T A 11: 117,759,512 (GRCm39) N326Y probably damaging Het
Tjp1 A T 7: 64,952,564 (GRCm39) F1590Y probably benign Het
Tle4 T C 19: 14,445,583 (GRCm39) N221S probably benign Het
Tln1 T C 4: 43,536,024 (GRCm39) T2054A probably damaging Het
Ttll4 A G 1: 74,718,949 (GRCm39) K267E probably benign Het
Usp32 C T 11: 84,913,118 (GRCm39) G930D probably damaging Het
Vmn2r75 T C 7: 85,813,447 (GRCm39) N452D probably damaging Het
Vmn2r81 T C 10: 79,104,028 (GRCm39) L217P possibly damaging Het
Wnt2 T A 6: 18,030,397 (GRCm39) probably benign Het
Zfp459 C T 13: 67,556,735 (GRCm39) S116N probably benign Het
Zfp981 C A 4: 146,622,410 (GRCm39) T445N possibly damaging Het
Other mutations in Nlrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Nlrp1b APN 11 71,072,007 (GRCm39) intron probably benign
IGL00571:Nlrp1b APN 11 71,054,799 (GRCm39) missense probably null 0.48
IGL01358:Nlrp1b APN 11 71,072,682 (GRCm39) missense possibly damaging 0.91
IGL01937:Nlrp1b APN 11 71,072,233 (GRCm39) missense probably damaging 0.98
IGL01945:Nlrp1b APN 11 71,072,233 (GRCm39) missense probably damaging 0.98
IGL02375:Nlrp1b APN 11 71,052,506 (GRCm39) missense probably damaging 1.00
IGL02552:Nlrp1b APN 11 71,063,057 (GRCm39) missense possibly damaging 0.96
IGL02552:Nlrp1b APN 11 71,072,878 (GRCm39) missense possibly damaging 0.57
IGL02588:Nlrp1b APN 11 71,073,105 (GRCm39) nonsense probably null
IGL02833:Nlrp1b APN 11 71,051,998 (GRCm39) missense probably benign
IGL02955:Nlrp1b APN 11 71,060,637 (GRCm39) missense possibly damaging 0.73
IGL03002:Nlrp1b APN 11 71,059,685 (GRCm39) missense probably benign 0.00
IGL03033:Nlrp1b APN 11 71,052,665 (GRCm39) missense probably benign 0.22
IGL03122:Nlrp1b APN 11 71,072,659 (GRCm39) missense probably benign 0.00
IGL03131:Nlrp1b APN 11 71,052,741 (GRCm39) missense possibly damaging 0.82
androcles UTSW 11 71,062,901 (GRCm39) nonsense probably null
Fangled UTSW 11 71,062,997 (GRCm39) missense possibly damaging 0.94
glitz UTSW 11 71,072,376 (GRCm39) missense possibly damaging 0.89
honeydew UTSW 11 71,108,710 (GRCm39) missense possibly damaging 0.93
Mush UTSW 11 71,046,905 (GRCm39) missense probably damaging 1.00
Thorn UTSW 11 71,047,126 (GRCm39) splice site probably benign
R0001:Nlrp1b UTSW 11 71,052,585 (GRCm39) missense probably damaging 1.00
R0022:Nlrp1b UTSW 11 71,052,755 (GRCm39) missense possibly damaging 0.61
R0022:Nlrp1b UTSW 11 71,052,755 (GRCm39) missense possibly damaging 0.61
R0038:Nlrp1b UTSW 11 71,062,997 (GRCm39) missense possibly damaging 0.94
R0038:Nlrp1b UTSW 11 71,062,997 (GRCm39) missense possibly damaging 0.94
R0164:Nlrp1b UTSW 11 71,054,925 (GRCm39) missense probably damaging 1.00
R0164:Nlrp1b UTSW 11 71,054,925 (GRCm39) missense probably damaging 1.00
R0271:Nlrp1b UTSW 11 71,052,591 (GRCm39) missense possibly damaging 0.51
R0464:Nlrp1b UTSW 11 71,109,070 (GRCm39) missense probably damaging 1.00
R0504:Nlrp1b UTSW 11 71,073,241 (GRCm39) missense probably damaging 0.99
R0605:Nlrp1b UTSW 11 71,047,005 (GRCm39) missense possibly damaging 0.88
R0863:Nlrp1b UTSW 11 71,072,173 (GRCm39) missense probably benign 0.00
R1075:Nlrp1b UTSW 11 71,072,512 (GRCm39) missense probably benign 0.35
R1221:Nlrp1b UTSW 11 71,072,290 (GRCm39) missense probably benign 0.07
R1501:Nlrp1b UTSW 11 71,046,885 (GRCm39) missense probably damaging 1.00
R1654:Nlrp1b UTSW 11 71,072,124 (GRCm39) missense probably damaging 0.99
R1671:Nlrp1b UTSW 11 71,092,085 (GRCm39) missense probably benign 0.45
R1676:Nlrp1b UTSW 11 71,073,637 (GRCm39) missense probably benign 0.13
R1694:Nlrp1b UTSW 11 71,107,681 (GRCm39) critical splice donor site probably null
R1709:Nlrp1b UTSW 11 71,092,099 (GRCm39) missense probably benign 0.11
R1770:Nlrp1b UTSW 11 71,050,979 (GRCm39) missense probably benign 0.22
R1775:Nlrp1b UTSW 11 71,052,647 (GRCm39) missense probably damaging 1.00
R1851:Nlrp1b UTSW 11 71,073,442 (GRCm39) missense possibly damaging 0.96
R1932:Nlrp1b UTSW 11 71,072,964 (GRCm39) missense probably damaging 0.96
R2063:Nlrp1b UTSW 11 71,051,912 (GRCm39) missense probably benign 0.09
R2189:Nlrp1b UTSW 11 71,060,621 (GRCm39) missense probably damaging 1.00
R2223:Nlrp1b UTSW 11 71,046,815 (GRCm39) splice site probably benign
R2284:Nlrp1b UTSW 11 71,047,110 (GRCm39) missense probably benign 0.00
R2434:Nlrp1b UTSW 11 71,047,552 (GRCm39) splice site probably null
R3079:Nlrp1b UTSW 11 71,108,794 (GRCm39) missense probably benign 0.27
R3775:Nlrp1b UTSW 11 71,047,126 (GRCm39) splice site probably benign
R3980:Nlrp1b UTSW 11 71,072,437 (GRCm39) missense possibly damaging 0.56
R4016:Nlrp1b UTSW 11 71,063,911 (GRCm39) missense probably damaging 1.00
R4085:Nlrp1b UTSW 11 71,052,588 (GRCm39) missense probably damaging 0.98
R4542:Nlrp1b UTSW 11 71,119,151 (GRCm39) missense probably damaging 1.00
R4623:Nlrp1b UTSW 11 71,052,669 (GRCm39) missense probably benign 0.00
R4726:Nlrp1b UTSW 11 71,072,232 (GRCm39) missense probably benign 0.10
R4764:Nlrp1b UTSW 11 71,073,489 (GRCm39) missense probably damaging 1.00
R4885:Nlrp1b UTSW 11 71,108,710 (GRCm39) missense possibly damaging 0.93
R4910:Nlrp1b UTSW 11 71,108,103 (GRCm39) missense probably benign 0.09
R4997:Nlrp1b UTSW 11 71,109,160 (GRCm39) missense probably damaging 1.00
R5046:Nlrp1b UTSW 11 71,050,898 (GRCm39) missense possibly damaging 0.95
R5126:Nlrp1b UTSW 11 71,072,359 (GRCm39) missense possibly damaging 0.67
R5369:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign
R5388:Nlrp1b UTSW 11 71,062,967 (GRCm39) missense probably damaging 1.00
R5445:Nlrp1b UTSW 11 71,108,701 (GRCm39) missense probably benign 0.21
R5546:Nlrp1b UTSW 11 71,108,102 (GRCm39) missense probably benign 0.04
R5567:Nlrp1b UTSW 11 71,072,229 (GRCm39) missense probably benign
R5826:Nlrp1b UTSW 11 71,072,022 (GRCm39) missense probably benign 0.17
R5955:Nlrp1b UTSW 11 71,108,691 (GRCm39) missense probably damaging 1.00
R5995:Nlrp1b UTSW 11 71,072,572 (GRCm39) missense probably damaging 1.00
R6059:Nlrp1b UTSW 11 71,107,836 (GRCm39) missense possibly damaging 0.53
R6170:Nlrp1b UTSW 11 71,046,905 (GRCm39) missense probably damaging 1.00
R6191:Nlrp1b UTSW 11 71,109,283 (GRCm39) nonsense probably null
R6250:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign 0.11
R6312:Nlrp1b UTSW 11 71,119,223 (GRCm39) missense probably benign 0.38
R6352:Nlrp1b UTSW 11 71,072,527 (GRCm39) missense probably damaging 0.99
R6807:Nlrp1b UTSW 11 71,108,530 (GRCm39) missense probably damaging 1.00
R6854:Nlrp1b UTSW 11 71,119,259 (GRCm39) missense possibly damaging 0.93
R6908:Nlrp1b UTSW 11 71,108,122 (GRCm39) missense probably benign
R6938:Nlrp1b UTSW 11 71,109,042 (GRCm39) missense probably damaging 1.00
R7098:Nlrp1b UTSW 11 71,109,100 (GRCm39) missense possibly damaging 0.89
R7142:Nlrp1b UTSW 11 71,062,901 (GRCm39) nonsense probably null
R7149:Nlrp1b UTSW 11 71,072,482 (GRCm39) nonsense probably null
R7349:Nlrp1b UTSW 11 71,072,943 (GRCm39) missense probably benign 0.36
R7354:Nlrp1b UTSW 11 71,072,376 (GRCm39) missense possibly damaging 0.89
R7750:Nlrp1b UTSW 11 71,059,665 (GRCm39) missense probably benign 0.11
R7913:Nlrp1b UTSW 11 71,108,537 (GRCm39) missense possibly damaging 0.93
R8031:Nlrp1b UTSW 11 71,107,747 (GRCm39) missense probably benign 0.15
R8087:Nlrp1b UTSW 11 71,062,897 (GRCm39) missense probably benign 0.04
R8164:Nlrp1b UTSW 11 71,119,243 (GRCm39) missense possibly damaging 0.78
R8378:Nlrp1b UTSW 11 71,052,545 (GRCm39) missense possibly damaging 0.95
R8405:Nlrp1b UTSW 11 71,073,356 (GRCm39) missense possibly damaging 0.66
R8441:Nlrp1b UTSW 11 71,073,204 (GRCm39) missense probably damaging 1.00
R8792:Nlrp1b UTSW 11 71,050,919 (GRCm39) missense probably benign 0.02
R8898:Nlrp1b UTSW 11 71,073,288 (GRCm39) missense probably damaging 1.00
R8953:Nlrp1b UTSW 11 71,052,632 (GRCm39) missense probably damaging 0.96
R8963:Nlrp1b UTSW 11 71,108,658 (GRCm39) missense probably damaging 1.00
R9184:Nlrp1b UTSW 11 71,072,067 (GRCm39) missense probably damaging 1.00
R9286:Nlrp1b UTSW 11 71,060,573 (GRCm39) missense probably benign
R9322:Nlrp1b UTSW 11 71,108,118 (GRCm39) missense probably benign 0.12
R9453:Nlrp1b UTSW 11 71,072,913 (GRCm39) missense probably damaging 0.98
R9533:Nlrp1b UTSW 11 71,109,095 (GRCm39) missense probably benign 0.12
R9659:Nlrp1b UTSW 11 71,073,132 (GRCm39) missense possibly damaging 0.77
Z1176:Nlrp1b UTSW 11 71,073,096 (GRCm39) missense probably damaging 1.00
Z1177:Nlrp1b UTSW 11 71,108,050 (GRCm39) missense probably benign 0.03
Z1177:Nlrp1b UTSW 11 71,072,125 (GRCm39) nonsense probably null
Z1186:Nlrp1b UTSW 11 71,073,370 (GRCm39) missense probably benign 0.00
Z1186:Nlrp1b UTSW 11 71,073,280 (GRCm39) missense probably benign 0.00
Z1186:Nlrp1b UTSW 11 71,073,266 (GRCm39) missense probably benign
Z1186:Nlrp1b UTSW 11 71,073,148 (GRCm39) missense probably benign
Z1186:Nlrp1b UTSW 11 71,073,135 (GRCm39) missense probably benign
Z1186:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign
Z1186:Nlrp1b UTSW 11 71,072,539 (GRCm39) missense probably benign
Z1186:Nlrp1b UTSW 11 71,072,534 (GRCm39) missense probably benign 0.02
Z1186:Nlrp1b UTSW 11 71,073,503 (GRCm39) missense probably benign
Z1186:Nlrp1b UTSW 11 71,073,396 (GRCm39) missense probably benign 0.02
Z1186:Nlrp1b UTSW 11 71,073,378 (GRCm39) missense probably benign
Z1187:Nlrp1b UTSW 11 71,073,370 (GRCm39) missense probably benign 0.00
Z1187:Nlrp1b UTSW 11 71,073,280 (GRCm39) missense probably benign 0.00
Z1187:Nlrp1b UTSW 11 71,073,266 (GRCm39) missense probably benign
Z1187:Nlrp1b UTSW 11 71,073,148 (GRCm39) missense probably benign
Z1187:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign
Z1187:Nlrp1b UTSW 11 71,072,539 (GRCm39) missense probably benign
Z1187:Nlrp1b UTSW 11 71,072,534 (GRCm39) missense probably benign 0.02
Z1187:Nlrp1b UTSW 11 71,073,503 (GRCm39) missense probably benign
Z1187:Nlrp1b UTSW 11 71,073,396 (GRCm39) missense probably benign 0.02
Z1187:Nlrp1b UTSW 11 71,073,378 (GRCm39) missense probably benign
Z1188:Nlrp1b UTSW 11 71,073,378 (GRCm39) missense probably benign
Z1188:Nlrp1b UTSW 11 71,073,396 (GRCm39) missense probably benign 0.02
Z1188:Nlrp1b UTSW 11 71,073,503 (GRCm39) missense probably benign
Z1188:Nlrp1b UTSW 11 71,072,534 (GRCm39) missense probably benign 0.02
Z1188:Nlrp1b UTSW 11 71,072,539 (GRCm39) missense probably benign
Z1188:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign
Z1188:Nlrp1b UTSW 11 71,073,135 (GRCm39) missense probably benign
Z1188:Nlrp1b UTSW 11 71,073,148 (GRCm39) missense probably benign
Z1188:Nlrp1b UTSW 11 71,073,266 (GRCm39) missense probably benign
Z1188:Nlrp1b UTSW 11 71,073,280 (GRCm39) missense probably benign 0.00
Z1188:Nlrp1b UTSW 11 71,073,370 (GRCm39) missense probably benign 0.00
Z1189:Nlrp1b UTSW 11 71,073,370 (GRCm39) missense probably benign 0.00
Z1189:Nlrp1b UTSW 11 71,073,280 (GRCm39) missense probably benign 0.00
Z1189:Nlrp1b UTSW 11 71,073,266 (GRCm39) missense probably benign
Z1189:Nlrp1b UTSW 11 71,073,148 (GRCm39) missense probably benign
Z1189:Nlrp1b UTSW 11 71,073,135 (GRCm39) missense probably benign
Z1189:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign
Z1189:Nlrp1b UTSW 11 71,072,539 (GRCm39) missense probably benign
Z1189:Nlrp1b UTSW 11 71,072,534 (GRCm39) missense probably benign 0.02
Z1189:Nlrp1b UTSW 11 71,073,503 (GRCm39) missense probably benign
Z1189:Nlrp1b UTSW 11 71,073,396 (GRCm39) missense probably benign 0.02
Z1189:Nlrp1b UTSW 11 71,073,378 (GRCm39) missense probably benign
Z1190:Nlrp1b UTSW 11 71,073,370 (GRCm39) missense probably benign 0.00
Z1190:Nlrp1b UTSW 11 71,073,378 (GRCm39) missense probably benign
Z1190:Nlrp1b UTSW 11 71,073,396 (GRCm39) missense probably benign 0.02
Z1190:Nlrp1b UTSW 11 71,073,503 (GRCm39) missense probably benign
Z1190:Nlrp1b UTSW 11 71,072,534 (GRCm39) missense probably benign 0.02
Z1190:Nlrp1b UTSW 11 71,072,539 (GRCm39) missense probably benign
Z1190:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign
Z1190:Nlrp1b UTSW 11 71,073,135 (GRCm39) missense probably benign
Z1190:Nlrp1b UTSW 11 71,073,148 (GRCm39) missense probably benign
Z1190:Nlrp1b UTSW 11 71,073,266 (GRCm39) missense probably benign
Z1190:Nlrp1b UTSW 11 71,073,280 (GRCm39) missense probably benign 0.00
Z1191:Nlrp1b UTSW 11 71,073,280 (GRCm39) missense probably benign 0.00
Z1191:Nlrp1b UTSW 11 71,073,266 (GRCm39) missense probably benign
Z1191:Nlrp1b UTSW 11 71,073,148 (GRCm39) missense probably benign
Z1191:Nlrp1b UTSW 11 71,073,135 (GRCm39) missense probably benign
Z1191:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign
Z1191:Nlrp1b UTSW 11 71,072,539 (GRCm39) missense probably benign
Z1191:Nlrp1b UTSW 11 71,072,534 (GRCm39) missense probably benign 0.02
Z1191:Nlrp1b UTSW 11 71,073,503 (GRCm39) missense probably benign
Z1191:Nlrp1b UTSW 11 71,073,396 (GRCm39) missense probably benign 0.02
Z1191:Nlrp1b UTSW 11 71,073,378 (GRCm39) missense probably benign
Z1191:Nlrp1b UTSW 11 71,073,370 (GRCm39) missense probably benign 0.00
Z1192:Nlrp1b UTSW 11 71,073,396 (GRCm39) missense probably benign 0.02
Z1192:Nlrp1b UTSW 11 71,073,378 (GRCm39) missense probably benign
Z1192:Nlrp1b UTSW 11 71,073,370 (GRCm39) missense probably benign 0.00
Z1192:Nlrp1b UTSW 11 71,073,280 (GRCm39) missense probably benign 0.00
Z1192:Nlrp1b UTSW 11 71,073,266 (GRCm39) missense probably benign
Z1192:Nlrp1b UTSW 11 71,073,148 (GRCm39) missense probably benign
Z1192:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign
Z1192:Nlrp1b UTSW 11 71,072,534 (GRCm39) missense probably benign 0.02
Z1192:Nlrp1b UTSW 11 71,073,503 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTAGAGCTGGCCTTCCTTC -3'
(R):5'- CAGGTGGCTAACTCAATCCAGATG -3'

Sequencing Primer
(F):5'- CCAGGCTCTCTTCACCTGC -3'
(R):5'- GGCTAACTCAATCCAGATGTTGAAG -3'
Posted On 2022-01-20