Incidental Mutation 'R9145:Usp32'
ID 694588
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 6430526O11Rik, 2900074J03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9145 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 84984442-85140161 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 85022292 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 930 (G930D)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect probably damaging
Transcript: ENSMUST00000000821
AA Change: G228D

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804
AA Change: G228D

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108075
AA Change: G930D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: G930D

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174602
SMART Domains Protein: ENSMUSP00000134476
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:DUSP 1 65 6.5e-17 PFAM
Pfam:Ubiquitin_3 122 216 8e-10 PFAM
Pfam:UCH 238 257 1.2e-7 PFAM
Meta Mutation Damage Score 0.9105 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,559,069 H720L probably benign Het
Abca15 T C 7: 120,388,165 Y1225H probably benign Het
Adck1 C A 12: 88,368,423 N26K probably benign Het
Adcy3 A G 12: 4,195,208 D382G probably damaging Het
Ahi1 T A 10: 21,000,589 C800S probably benign Het
Ahnak G T 19: 9,014,923 V4524L probably benign Het
Apol11a C T 15: 77,513,578 A43V probably benign Het
Arid1a T C 4: 133,693,903 M479V unknown Het
Atp13a2 T A 4: 140,996,745 C324S probably damaging Het
C2cd2 T G 16: 97,876,286 T413P probably damaging Het
Cct5 A C 15: 31,590,961 D531E Het
Chst1 A T 2: 92,614,178 I332F probably damaging Het
Col12a1 A T 9: 79,620,062 V2662D probably benign Het
Cts3 A G 13: 61,564,986 Y307H probably benign Het
D630023F18Rik G A 1: 65,121,212 probably benign Het
Dhx9 A G 1: 153,461,080 I807T probably damaging Het
Doxl2 C A 6: 48,975,956 R272S probably benign Het
Exoc3l4 T C 12: 111,422,152 L25P probably benign Het
Ggcx T A 6: 72,425,922 C288S probably benign Het
Gjb3 A G 4: 127,326,347 Y131H probably damaging Het
Hdhd3 A G 4: 62,499,337 S201P probably benign Het
Helz2 A T 2: 181,240,055 V315E probably damaging Het
Hsp90aa1 A G 12: 110,696,250 probably null Het
Il12a C T 3: 68,691,542 R19W unknown Het
Isoc1 C T 18: 58,673,275 A219V possibly damaging Het
Jup T A 11: 100,378,298 T430S probably benign Het
Klra5 C T 6: 129,909,948 C39Y probably benign Het
Map4 A T 9: 110,026,200 Q131L probably damaging Het
Mau2 T A 8: 70,027,515 K314M probably damaging Het
Mga A G 2: 119,964,012 M2726V probably benign Het
Mgme1 G A 2: 144,272,485 probably null Het
Msrb2 A G 2: 19,394,255 E143G probably benign Het
Muc5b G T 7: 141,857,613 C1432F unknown Het
Naglu T C 11: 101,071,114 Y138H probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nlrp1b A G 11: 71,218,367 Y103H probably benign Het
Nodal A G 10: 61,423,680 N299D probably damaging Het
Notch1 T C 2: 26,459,575 T2518A probably benign Het
Nr2e1 A C 10: 42,572,952 S97A probably benign Het
Nuak1 A T 10: 84,374,723 S500R probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Nyap1 T C 5: 137,737,913 E104G probably benign Het
Olfr401 C T 11: 74,121,700 T137I probably benign Het
Olfr670 T A 7: 104,959,997 H245L probably damaging Het
Palld T C 8: 61,877,073 T257A probably benign Het
Pcnx4 C T 12: 72,556,269 P435L probably damaging Het
Piezo1 T C 8: 122,482,014 T2538A unknown Het
Plagl1 T C 10: 13,128,128 L380P unknown Het
Polrmt G T 10: 79,740,581 Q514K probably benign Het
Psg17 T G 7: 18,819,926 D133A probably benign Het
Rab3b G A 4: 108,940,706 D185N probably benign Het
Ranbp2 T A 10: 58,455,914 S248T probably benign Het
Rdh10 C A 1: 16,129,206 A212D probably damaging Het
Rinl A G 7: 28,795,664 H154R Het
Selenbp1 T C 3: 94,944,103 M389T probably benign Het
Serpina1c T A 12: 103,896,141 H305L possibly damaging Het
Sh3rf2 T A 18: 42,149,681 S467T Het
Sipa1l1 A G 12: 82,396,561 D875G probably benign Het
Slc10a6 A T 5: 103,628,934 V100D probably damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Slc20a2 T C 8: 22,540,431 F168L probably benign Het
Slc25a1 A T 16: 17,927,244 probably null Het
Slc5a12 A G 2: 110,640,897 S495G probably benign Het
Smpdl3a A G 10: 57,800,932 D42G possibly damaging Het
Spag16 G C 1: 70,381,300 L482F probably damaging Het
Susd5 G A 9: 114,096,221 G391R probably damaging Het
Sync G T 4: 129,293,825 A217S Het
Tha1 T A 11: 117,868,686 N326Y probably damaging Het
Tjp1 A T 7: 65,302,816 F1590Y probably benign Het
Tle4 T C 19: 14,468,219 N221S probably benign Het
Tln1 T C 4: 43,536,024 T2054A probably damaging Het
Ttc30a1 A T 2: 75,980,079 Y553* probably null Het
Ttll4 A G 1: 74,679,790 K267E probably benign Het
Vmn2r75 T C 7: 86,164,239 N452D probably damaging Het
Vmn2r81 T C 10: 79,268,194 L217P possibly damaging Het
Wnt2 T A 6: 18,030,398 probably benign Het
Zfp459 C T 13: 67,408,616 S116N probably benign Het
Zfp981 C A 4: 146,537,953 T445N possibly damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
BB010:Usp32 UTSW 11 85007059 missense probably damaging 1.00
BB020:Usp32 UTSW 11 85007059 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7933:Usp32 UTSW 11 85007059 missense probably damaging 1.00
R7973:Usp32 UTSW 11 85022808 missense probably damaging 0.99
R7989:Usp32 UTSW 11 85034300 missense
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
R8292:Usp32 UTSW 11 85077401 missense probably damaging 0.99
R8305:Usp32 UTSW 11 85032185 missense possibly damaging 0.83
R8548:Usp32 UTSW 11 85017827 missense possibly damaging 0.52
R8924:Usp32 UTSW 11 85025544 missense probably damaging 0.98
R9002:Usp32 UTSW 11 85053951 missense probably damaging 0.96
R9209:Usp32 UTSW 11 85040012 missense probably damaging 0.98
R9211:Usp32 UTSW 11 85022733 missense probably damaging 1.00
R9296:Usp32 UTSW 11 85017652 missense probably damaging 1.00
R9310:Usp32 UTSW 11 85051202 missense probably benign 0.29
R9417:Usp32 UTSW 11 84994543 missense probably damaging 1.00
R9514:Usp32 UTSW 11 85022734 missense probably damaging 0.99
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTTTCTGGTAGACAACATTTTCA -3'
(R):5'- GCCAATCAGAAGTCTTTATCAGATAGA -3'

Sequencing Primer
(F):5'- GTACATAGTGAGCCTCTGACTCAAG -3'
(R):5'- GTTTGCTATTTGCAAGTCAG -3'
Posted On 2022-01-20