Incidental Mutation 'R9145:Adcy3'
ID 694592
Institutional Source Beutler Lab
Gene Symbol Adcy3
Ensembl Gene ENSMUSG00000020654
Gene Name adenylate cyclase 3
Synonyms AC3, ACIII
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.877) question?
Stock # R9145 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 4183397-4263525 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4245208 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 382 (D382G)
Ref Sequence ENSEMBL: ENSMUSP00000020984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020984] [ENSMUST00000111169] [ENSMUST00000124505] [ENSMUST00000127756] [ENSMUST00000152065]
AlphaFold Q8VHH7
Predicted Effect probably damaging
Transcript: ENSMUST00000020984
AA Change: D382G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020984
Gene: ENSMUSG00000020654
AA Change: D382G

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 841 858 N/A INTRINSIC
CYCc 884 1103 2.02e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111169
SMART Domains Protein: ENSMUSP00000106799
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
coiled coil region 39 74 N/A INTRINSIC
Pfam:CENP-O 118 195 2.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124505
AA Change: D382G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122073
Gene: ENSMUSG00000020654
AA Change: D382G

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 840 857 N/A INTRINSIC
CYCc 883 1102 2.02e-70 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127756
AA Change: D382G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115406
Gene: ENSMUSG00000020654
AA Change: D382G

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 841 858 N/A INTRINSIC
CYCc 884 1103 2.02e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146261
Predicted Effect probably damaging
Transcript: ENSMUST00000152065
AA Change: D382G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115644
Gene: ENSMUSG00000020654
AA Change: D382G

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 840 857 N/A INTRINSIC
CYCc 883 1102 2.02e-70 SMART
Meta Mutation Damage Score 0.8504 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes adenylyl cyclase 3 which is a membrane-associated enzyme and catalyzes the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This protein appears to be widely expressed in various human tissues and may be involved in a number of physiological and pathophysiological metabolic processes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for one mutation of this gene display impaired olfaction and disorganization of glomeruli in the main olfactory bulb. Mutant animals also appear to be sterile as homozygous matings failed to produce litters. Mice with another mutant allele fail to survive beyond weaning. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,536,032 (GRCm39) H720L probably benign Het
Abca15 T C 7: 119,987,388 (GRCm39) Y1225H probably benign Het
Adck1 C A 12: 88,335,193 (GRCm39) N26K probably benign Het
Ahi1 T A 10: 20,876,488 (GRCm39) C800S probably benign Het
Ahnak G T 19: 8,992,287 (GRCm39) V4524L probably benign Het
Aoc1l1 C A 6: 48,952,890 (GRCm39) R272S probably benign Het
Apol11a C T 15: 77,397,778 (GRCm39) A43V probably benign Het
Arid1a T C 4: 133,421,214 (GRCm39) M479V unknown Het
Atp13a2 T A 4: 140,724,056 (GRCm39) C324S probably damaging Het
C2cd2 T G 16: 97,677,486 (GRCm39) T413P probably damaging Het
Cct5 A C 15: 31,591,107 (GRCm39) D531E Het
Chst1 A T 2: 92,444,523 (GRCm39) I332F probably damaging Het
Col12a1 A T 9: 79,527,344 (GRCm39) V2662D probably benign Het
Cts3 A G 13: 61,712,800 (GRCm39) Y307H probably benign Het
D630023F18Rik G A 1: 65,160,371 (GRCm39) probably benign Het
Dhx9 A G 1: 153,336,826 (GRCm39) I807T probably damaging Het
Exoc3l4 T C 12: 111,388,586 (GRCm39) L25P probably benign Het
Ggcx T A 6: 72,402,905 (GRCm39) C288S probably benign Het
Gjb3 A G 4: 127,220,140 (GRCm39) Y131H probably damaging Het
Hdhd3 A G 4: 62,417,574 (GRCm39) S201P probably benign Het
Helz2 A T 2: 180,881,848 (GRCm39) V315E probably damaging Het
Hsp90aa1 A G 12: 110,662,684 (GRCm39) probably null Het
Ift70a1 A T 2: 75,810,423 (GRCm39) Y553* probably null Het
Il12a C T 3: 68,598,875 (GRCm39) R19W unknown Het
Isoc1 C T 18: 58,806,347 (GRCm39) A219V possibly damaging Het
Jup T A 11: 100,269,124 (GRCm39) T430S probably benign Het
Klra5 C T 6: 129,886,911 (GRCm39) C39Y probably benign Het
Map4 A T 9: 109,855,268 (GRCm39) Q131L probably damaging Het
Mau2 T A 8: 70,480,165 (GRCm39) K314M probably damaging Het
Mga A G 2: 119,794,493 (GRCm39) M2726V probably benign Het
Mgme1 G A 2: 144,114,405 (GRCm39) probably null Het
Msrb2 A G 2: 19,399,066 (GRCm39) E143G probably benign Het
Muc5b G T 7: 141,411,350 (GRCm39) C1432F unknown Het
Naglu T C 11: 100,961,940 (GRCm39) Y138H probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nlrp1b A G 11: 71,109,193 (GRCm39) Y103H probably benign Het
Nodal A G 10: 61,259,459 (GRCm39) N299D probably damaging Het
Notch1 T C 2: 26,349,587 (GRCm39) T2518A probably benign Het
Nr2e1 A C 10: 42,448,948 (GRCm39) S97A probably benign Het
Nuak1 A T 10: 84,210,587 (GRCm39) S500R probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Nyap1 T C 5: 137,736,175 (GRCm39) E104G probably benign Het
Or3a1b C T 11: 74,012,526 (GRCm39) T137I probably benign Het
Or52e18 T A 7: 104,609,204 (GRCm39) H245L probably damaging Het
Palld T C 8: 62,330,107 (GRCm39) T257A probably benign Het
Pcnx4 C T 12: 72,603,043 (GRCm39) P435L probably damaging Het
Piezo1 T C 8: 123,208,753 (GRCm39) T2538A unknown Het
Plagl1 T C 10: 13,003,872 (GRCm39) L380P unknown Het
Polrmt G T 10: 79,576,415 (GRCm39) Q514K probably benign Het
Psg17 T G 7: 18,553,851 (GRCm39) D133A probably benign Het
Rab3b G A 4: 108,797,903 (GRCm39) D185N probably benign Het
Ranbp2 T A 10: 58,291,736 (GRCm39) S248T probably benign Het
Rdh10 C A 1: 16,199,430 (GRCm39) A212D probably damaging Het
Rinl A G 7: 28,495,089 (GRCm39) H154R Het
Selenbp1 T C 3: 94,851,414 (GRCm39) M389T probably benign Het
Serpina1c T A 12: 103,862,400 (GRCm39) H305L possibly damaging Het
Sh3rf2 T A 18: 42,282,746 (GRCm39) S467T Het
Sipa1l1 A G 12: 82,443,335 (GRCm39) D875G probably benign Het
Slc10a6 A T 5: 103,776,800 (GRCm39) V100D probably damaging Het
Slc13a4 T C 6: 35,247,290 (GRCm39) I577V possibly damaging Het
Slc20a2 T C 8: 23,030,447 (GRCm39) F168L probably benign Het
Slc25a1 A T 16: 17,745,108 (GRCm39) probably null Het
Slc5a12 A G 2: 110,471,242 (GRCm39) S495G probably benign Het
Smpdl3a A G 10: 57,677,028 (GRCm39) D42G possibly damaging Het
Spag16 G C 1: 70,420,459 (GRCm39) L482F probably damaging Het
Susd5 G A 9: 113,925,289 (GRCm39) G391R probably damaging Het
Sync G T 4: 129,187,618 (GRCm39) A217S Het
Tha1 T A 11: 117,759,512 (GRCm39) N326Y probably damaging Het
Tjp1 A T 7: 64,952,564 (GRCm39) F1590Y probably benign Het
Tle4 T C 19: 14,445,583 (GRCm39) N221S probably benign Het
Tln1 T C 4: 43,536,024 (GRCm39) T2054A probably damaging Het
Ttll4 A G 1: 74,718,949 (GRCm39) K267E probably benign Het
Usp32 C T 11: 84,913,118 (GRCm39) G930D probably damaging Het
Vmn2r75 T C 7: 85,813,447 (GRCm39) N452D probably damaging Het
Vmn2r81 T C 10: 79,104,028 (GRCm39) L217P possibly damaging Het
Wnt2 T A 6: 18,030,397 (GRCm39) probably benign Het
Zfp459 C T 13: 67,556,735 (GRCm39) S116N probably benign Het
Zfp981 C A 4: 146,622,410 (GRCm39) T445N possibly damaging Het
Other mutations in Adcy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Adcy3 APN 12 4,244,357 (GRCm39) missense probably damaging 1.00
IGL00985:Adcy3 APN 12 4,184,600 (GRCm39) missense probably damaging 0.98
IGL01735:Adcy3 APN 12 4,251,213 (GRCm39) missense probably benign 0.00
IGL02097:Adcy3 APN 12 4,262,118 (GRCm39) missense probably damaging 1.00
IGL02102:Adcy3 APN 12 4,184,699 (GRCm39) missense probably damaging 1.00
IGL02103:Adcy3 APN 12 4,184,390 (GRCm39) missense possibly damaging 0.69
IGL02155:Adcy3 APN 12 4,262,142 (GRCm39) nonsense probably null
IGL02376:Adcy3 APN 12 4,251,031 (GRCm39) missense possibly damaging 0.77
IGL02411:Adcy3 APN 12 4,259,407 (GRCm39) splice site probably null
IGL02465:Adcy3 APN 12 4,250,906 (GRCm39) missense probably benign 0.10
IGL02819:Adcy3 APN 12 4,256,986 (GRCm39) splice site probably benign
magnificent_frigatebird UTSW 12 4,244,324 (GRCm39) missense probably damaging 1.00
R0015:Adcy3 UTSW 12 4,245,260 (GRCm39) critical splice donor site probably null
R0015:Adcy3 UTSW 12 4,245,260 (GRCm39) critical splice donor site probably null
R0918:Adcy3 UTSW 12 4,248,360 (GRCm39) missense probably benign 0.05
R1480:Adcy3 UTSW 12 4,262,171 (GRCm39) missense probably damaging 1.00
R1736:Adcy3 UTSW 12 4,250,998 (GRCm39) missense possibly damaging 0.87
R1885:Adcy3 UTSW 12 4,184,951 (GRCm39) missense probably damaging 1.00
R1897:Adcy3 UTSW 12 4,223,450 (GRCm39) splice site probably benign
R1951:Adcy3 UTSW 12 4,258,624 (GRCm39) missense probably benign 0.29
R2083:Adcy3 UTSW 12 4,223,512 (GRCm39) missense probably damaging 1.00
R2417:Adcy3 UTSW 12 4,258,627 (GRCm39) missense probably benign 0.05
R4379:Adcy3 UTSW 12 4,184,558 (GRCm39) missense probably damaging 1.00
R4785:Adcy3 UTSW 12 4,256,542 (GRCm39) missense probably benign 0.00
R4960:Adcy3 UTSW 12 4,184,896 (GRCm39) missense probably benign 0.11
R5001:Adcy3 UTSW 12 4,248,434 (GRCm39) missense possibly damaging 0.56
R5166:Adcy3 UTSW 12 4,184,438 (GRCm39) missense probably damaging 1.00
R5375:Adcy3 UTSW 12 4,260,870 (GRCm39) missense probably damaging 1.00
R5416:Adcy3 UTSW 12 4,259,308 (GRCm39) missense probably damaging 1.00
R5998:Adcy3 UTSW 12 4,248,348 (GRCm39) missense probably damaging 1.00
R6248:Adcy3 UTSW 12 4,258,662 (GRCm39) critical splice donor site probably null
R6490:Adcy3 UTSW 12 4,262,150 (GRCm39) missense probably damaging 1.00
R6566:Adcy3 UTSW 12 4,244,324 (GRCm39) missense probably damaging 1.00
R7145:Adcy3 UTSW 12 4,250,992 (GRCm39) missense probably benign 0.20
R7283:Adcy3 UTSW 12 4,253,563 (GRCm39) missense not run
R7559:Adcy3 UTSW 12 4,248,440 (GRCm39) missense probably benign 0.06
R7691:Adcy3 UTSW 12 4,256,540 (GRCm39) missense probably benign 0.17
R7799:Adcy3 UTSW 12 4,254,762 (GRCm39) missense probably damaging 1.00
R8074:Adcy3 UTSW 12 4,184,420 (GRCm39) missense probably benign 0.00
R8283:Adcy3 UTSW 12 4,250,935 (GRCm39) missense probably damaging 1.00
R8298:Adcy3 UTSW 12 4,256,482 (GRCm39) missense probably damaging 1.00
R8515:Adcy3 UTSW 12 4,262,187 (GRCm39) missense probably damaging 1.00
R9361:Adcy3 UTSW 12 4,259,366 (GRCm39) missense possibly damaging 0.80
R9464:Adcy3 UTSW 12 4,256,939 (GRCm39) missense probably benign
R9643:Adcy3 UTSW 12 4,259,455 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCGTAAGTCCCAAATGC -3'
(R):5'- ATCCCAAACTCCGGTTTCCAG -3'

Sequencing Primer
(F):5'- TGCTACTGGGCTCCTCGAC -3'
(R):5'- AACAAACAAAAACAAGCCAGAACTG -3'
Posted On 2022-01-20