Incidental Mutation 'R9145:Adck1'
ID 694595
Institutional Source Beutler Lab
Gene Symbol Adck1
Ensembl Gene ENSMUSG00000021044
Gene Name aarF domain containing kinase 1
Synonyms 2610005A10Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9145 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 88327324-88428494 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 88335193 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 26 (N26K)
Ref Sequence ENSEMBL: ENSMUSP00000098724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101165] [ENSMUST00000166940] [ENSMUST00000222695]
AlphaFold Q9D0L4
Predicted Effect probably benign
Transcript: ENSMUST00000101165
AA Change: N26K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000098724
Gene: ENSMUSG00000021044
AA Change: N26K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
Pfam:ABC1 136 252 1.7e-42 PFAM
Pfam:Pkinase 150 348 1.3e-5 PFAM
low complexity region 498 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166940
AA Change: N26K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127254
Gene: ENSMUSG00000021044
AA Change: N26K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
Pfam:ABC1 136 252 2.2e-42 PFAM
Pfam:Pkinase 150 357 6.2e-6 PFAM
low complexity region 498 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222695
AA Change: N26K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.1057 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,536,032 (GRCm39) H720L probably benign Het
Abca15 T C 7: 119,987,388 (GRCm39) Y1225H probably benign Het
Adcy3 A G 12: 4,245,208 (GRCm39) D382G probably damaging Het
Ahi1 T A 10: 20,876,488 (GRCm39) C800S probably benign Het
Ahnak G T 19: 8,992,287 (GRCm39) V4524L probably benign Het
Aoc1l1 C A 6: 48,952,890 (GRCm39) R272S probably benign Het
Apol11a C T 15: 77,397,778 (GRCm39) A43V probably benign Het
Arid1a T C 4: 133,421,214 (GRCm39) M479V unknown Het
Atp13a2 T A 4: 140,724,056 (GRCm39) C324S probably damaging Het
C2cd2 T G 16: 97,677,486 (GRCm39) T413P probably damaging Het
Cct5 A C 15: 31,591,107 (GRCm39) D531E Het
Chst1 A T 2: 92,444,523 (GRCm39) I332F probably damaging Het
Col12a1 A T 9: 79,527,344 (GRCm39) V2662D probably benign Het
Cts3 A G 13: 61,712,800 (GRCm39) Y307H probably benign Het
D630023F18Rik G A 1: 65,160,371 (GRCm39) probably benign Het
Dhx9 A G 1: 153,336,826 (GRCm39) I807T probably damaging Het
Exoc3l4 T C 12: 111,388,586 (GRCm39) L25P probably benign Het
Ggcx T A 6: 72,402,905 (GRCm39) C288S probably benign Het
Gjb3 A G 4: 127,220,140 (GRCm39) Y131H probably damaging Het
Hdhd3 A G 4: 62,417,574 (GRCm39) S201P probably benign Het
Helz2 A T 2: 180,881,848 (GRCm39) V315E probably damaging Het
Hsp90aa1 A G 12: 110,662,684 (GRCm39) probably null Het
Ift70a1 A T 2: 75,810,423 (GRCm39) Y553* probably null Het
Il12a C T 3: 68,598,875 (GRCm39) R19W unknown Het
Isoc1 C T 18: 58,806,347 (GRCm39) A219V possibly damaging Het
Jup T A 11: 100,269,124 (GRCm39) T430S probably benign Het
Klra5 C T 6: 129,886,911 (GRCm39) C39Y probably benign Het
Map4 A T 9: 109,855,268 (GRCm39) Q131L probably damaging Het
Mau2 T A 8: 70,480,165 (GRCm39) K314M probably damaging Het
Mga A G 2: 119,794,493 (GRCm39) M2726V probably benign Het
Mgme1 G A 2: 144,114,405 (GRCm39) probably null Het
Msrb2 A G 2: 19,399,066 (GRCm39) E143G probably benign Het
Muc5b G T 7: 141,411,350 (GRCm39) C1432F unknown Het
Naglu T C 11: 100,961,940 (GRCm39) Y138H probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nlrp1b A G 11: 71,109,193 (GRCm39) Y103H probably benign Het
Nodal A G 10: 61,259,459 (GRCm39) N299D probably damaging Het
Notch1 T C 2: 26,349,587 (GRCm39) T2518A probably benign Het
Nr2e1 A C 10: 42,448,948 (GRCm39) S97A probably benign Het
Nuak1 A T 10: 84,210,587 (GRCm39) S500R probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Nyap1 T C 5: 137,736,175 (GRCm39) E104G probably benign Het
Or3a1b C T 11: 74,012,526 (GRCm39) T137I probably benign Het
Or52e18 T A 7: 104,609,204 (GRCm39) H245L probably damaging Het
Palld T C 8: 62,330,107 (GRCm39) T257A probably benign Het
Pcnx4 C T 12: 72,603,043 (GRCm39) P435L probably damaging Het
Piezo1 T C 8: 123,208,753 (GRCm39) T2538A unknown Het
Plagl1 T C 10: 13,003,872 (GRCm39) L380P unknown Het
Polrmt G T 10: 79,576,415 (GRCm39) Q514K probably benign Het
Psg17 T G 7: 18,553,851 (GRCm39) D133A probably benign Het
Rab3b G A 4: 108,797,903 (GRCm39) D185N probably benign Het
Ranbp2 T A 10: 58,291,736 (GRCm39) S248T probably benign Het
Rdh10 C A 1: 16,199,430 (GRCm39) A212D probably damaging Het
Rinl A G 7: 28,495,089 (GRCm39) H154R Het
Selenbp1 T C 3: 94,851,414 (GRCm39) M389T probably benign Het
Serpina1c T A 12: 103,862,400 (GRCm39) H305L possibly damaging Het
Sh3rf2 T A 18: 42,282,746 (GRCm39) S467T Het
Sipa1l1 A G 12: 82,443,335 (GRCm39) D875G probably benign Het
Slc10a6 A T 5: 103,776,800 (GRCm39) V100D probably damaging Het
Slc13a4 T C 6: 35,247,290 (GRCm39) I577V possibly damaging Het
Slc20a2 T C 8: 23,030,447 (GRCm39) F168L probably benign Het
Slc25a1 A T 16: 17,745,108 (GRCm39) probably null Het
Slc5a12 A G 2: 110,471,242 (GRCm39) S495G probably benign Het
Smpdl3a A G 10: 57,677,028 (GRCm39) D42G possibly damaging Het
Spag16 G C 1: 70,420,459 (GRCm39) L482F probably damaging Het
Susd5 G A 9: 113,925,289 (GRCm39) G391R probably damaging Het
Sync G T 4: 129,187,618 (GRCm39) A217S Het
Tha1 T A 11: 117,759,512 (GRCm39) N326Y probably damaging Het
Tjp1 A T 7: 64,952,564 (GRCm39) F1590Y probably benign Het
Tle4 T C 19: 14,445,583 (GRCm39) N221S probably benign Het
Tln1 T C 4: 43,536,024 (GRCm39) T2054A probably damaging Het
Ttll4 A G 1: 74,718,949 (GRCm39) K267E probably benign Het
Usp32 C T 11: 84,913,118 (GRCm39) G930D probably damaging Het
Vmn2r75 T C 7: 85,813,447 (GRCm39) N452D probably damaging Het
Vmn2r81 T C 10: 79,104,028 (GRCm39) L217P possibly damaging Het
Wnt2 T A 6: 18,030,397 (GRCm39) probably benign Het
Zfp459 C T 13: 67,556,735 (GRCm39) S116N probably benign Het
Zfp981 C A 4: 146,622,410 (GRCm39) T445N possibly damaging Het
Other mutations in Adck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Adck1 APN 12 88,335,192 (GRCm39) missense probably benign 0.00
IGL00822:Adck1 APN 12 88,422,286 (GRCm39) missense probably damaging 0.99
IGL01370:Adck1 APN 12 88,423,503 (GRCm39) splice site probably benign
IGL01480:Adck1 APN 12 88,423,635 (GRCm39) nonsense probably null
IGL01994:Adck1 APN 12 88,397,926 (GRCm39) missense possibly damaging 0.50
IGL02089:Adck1 APN 12 88,413,480 (GRCm39) missense probably damaging 0.96
IGL03058:Adck1 APN 12 88,425,900 (GRCm39) missense probably benign
IGL03196:Adck1 APN 12 88,397,885 (GRCm39) missense probably damaging 1.00
IGL03307:Adck1 APN 12 88,425,823 (GRCm39) missense possibly damaging 0.94
full-figured UTSW 12 88,407,887 (GRCm39) missense possibly damaging 0.63
0152:Adck1 UTSW 12 88,397,921 (GRCm39) missense probably benign 0.03
R0107:Adck1 UTSW 12 88,413,426 (GRCm39) missense possibly damaging 0.62
R0164:Adck1 UTSW 12 88,422,280 (GRCm39) missense probably damaging 0.99
R0164:Adck1 UTSW 12 88,422,280 (GRCm39) missense probably damaging 0.99
R0179:Adck1 UTSW 12 88,425,942 (GRCm39) missense possibly damaging 0.91
R0505:Adck1 UTSW 12 88,338,461 (GRCm39) splice site probably benign
R0561:Adck1 UTSW 12 88,335,204 (GRCm39) missense possibly damaging 0.49
R0831:Adck1 UTSW 12 88,335,118 (GRCm39) start codon destroyed probably null 1.00
R1005:Adck1 UTSW 12 88,368,872 (GRCm39) missense probably damaging 0.98
R1524:Adck1 UTSW 12 88,368,854 (GRCm39) missense probably damaging 1.00
R2016:Adck1 UTSW 12 88,427,862 (GRCm39) missense probably damaging 1.00
R4438:Adck1 UTSW 12 88,397,920 (GRCm39) nonsense probably null
R4745:Adck1 UTSW 12 88,368,949 (GRCm39) splice site probably null
R4827:Adck1 UTSW 12 88,413,489 (GRCm39) missense probably benign 0.06
R4859:Adck1 UTSW 12 88,407,865 (GRCm39) missense probably benign 0.02
R4885:Adck1 UTSW 12 88,407,865 (GRCm39) missense probably benign 0.02
R4921:Adck1 UTSW 12 88,407,908 (GRCm39) missense probably benign 0.10
R5383:Adck1 UTSW 12 88,422,373 (GRCm39) missense probably benign 0.04
R5958:Adck1 UTSW 12 88,425,822 (GRCm39) missense probably benign 0.33
R6028:Adck1 UTSW 12 88,368,902 (GRCm39) missense probably benign
R6199:Adck1 UTSW 12 88,407,887 (GRCm39) missense possibly damaging 0.63
R6317:Adck1 UTSW 12 88,368,921 (GRCm39) missense probably damaging 1.00
R6616:Adck1 UTSW 12 88,427,958 (GRCm39) missense unknown
R6715:Adck1 UTSW 12 88,425,850 (GRCm39) missense probably damaging 1.00
R6915:Adck1 UTSW 12 88,422,390 (GRCm39) missense probably damaging 1.00
R7295:Adck1 UTSW 12 88,397,815 (GRCm39) missense probably damaging 1.00
R7387:Adck1 UTSW 12 88,427,822 (GRCm39) missense probably benign
R7520:Adck1 UTSW 12 88,425,975 (GRCm39) critical splice donor site probably null
R7562:Adck1 UTSW 12 88,335,203 (GRCm39) missense possibly damaging 0.77
R7745:Adck1 UTSW 12 88,423,570 (GRCm39) missense probably benign
R7759:Adck1 UTSW 12 88,368,887 (GRCm39) missense possibly damaging 0.65
R8092:Adck1 UTSW 12 88,427,831 (GRCm39) missense possibly damaging 0.68
R8336:Adck1 UTSW 12 88,335,249 (GRCm39) missense probably damaging 1.00
R9443:Adck1 UTSW 12 88,338,550 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTAGAACACAAGGCACCTG -3'
(R):5'- GCTGACATGCCTGCATTTCG -3'

Sequencing Primer
(F):5'- TATTAGGTGCCACGCTAAGC -3'
(R):5'- TCGATATATGTGAGCACGCC -3'
Posted On 2022-01-20