Incidental Mutation 'R9145:Adck1'
ID 694595
Institutional Source Beutler Lab
Gene Symbol Adck1
Ensembl Gene ENSMUSG00000021044
Gene Name aarF domain containing kinase 1
Synonyms 2610005A10Rik
Accession Numbers

Genbank: NM_028105; MGI:1919363

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9145 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 88360554-88461724 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 88368423 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 26 (N26K)
Ref Sequence ENSEMBL: ENSMUSP00000098724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101165] [ENSMUST00000166940] [ENSMUST00000222695]
AlphaFold Q9D0L4
Predicted Effect probably benign
Transcript: ENSMUST00000101165
AA Change: N26K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000098724
Gene: ENSMUSG00000021044
AA Change: N26K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
Pfam:ABC1 136 252 1.7e-42 PFAM
Pfam:Pkinase 150 348 1.3e-5 PFAM
low complexity region 498 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166940
AA Change: N26K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127254
Gene: ENSMUSG00000021044
AA Change: N26K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
Pfam:ABC1 136 252 2.2e-42 PFAM
Pfam:Pkinase 150 357 6.2e-6 PFAM
low complexity region 498 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222695
AA Change: N26K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.1057 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,559,069 H720L probably benign Het
Abca15 T C 7: 120,388,165 Y1225H probably benign Het
Adcy3 A G 12: 4,195,208 D382G probably damaging Het
Ahi1 T A 10: 21,000,589 C800S probably benign Het
Ahnak G T 19: 9,014,923 V4524L probably benign Het
Apol11a C T 15: 77,513,578 A43V probably benign Het
Arid1a T C 4: 133,693,903 M479V unknown Het
Atp13a2 T A 4: 140,996,745 C324S probably damaging Het
C2cd2 T G 16: 97,876,286 T413P probably damaging Het
Cct5 A C 15: 31,590,961 D531E Het
Chst1 A T 2: 92,614,178 I332F probably damaging Het
Col12a1 A T 9: 79,620,062 V2662D probably benign Het
Cts3 A G 13: 61,564,986 Y307H probably benign Het
D630023F18Rik G A 1: 65,121,212 probably benign Het
Dhx9 A G 1: 153,461,080 I807T probably damaging Het
Doxl2 C A 6: 48,975,956 R272S probably benign Het
Exoc3l4 T C 12: 111,422,152 L25P probably benign Het
Ggcx T A 6: 72,425,922 C288S probably benign Het
Gjb3 A G 4: 127,326,347 Y131H probably damaging Het
Hdhd3 A G 4: 62,499,337 S201P probably benign Het
Helz2 A T 2: 181,240,055 V315E probably damaging Het
Hsp90aa1 A G 12: 110,696,250 probably null Het
Il12a C T 3: 68,691,542 R19W unknown Het
Isoc1 C T 18: 58,673,275 A219V possibly damaging Het
Jup T A 11: 100,378,298 T430S probably benign Het
Klra5 C T 6: 129,909,948 C39Y probably benign Het
Map4 A T 9: 110,026,200 Q131L probably damaging Het
Mau2 T A 8: 70,027,515 K314M probably damaging Het
Mga A G 2: 119,964,012 M2726V probably benign Het
Mgme1 G A 2: 144,272,485 probably null Het
Msrb2 A G 2: 19,394,255 E143G probably benign Het
Muc5b G T 7: 141,857,613 C1432F unknown Het
Naglu T C 11: 101,071,114 Y138H probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nlrp1b A G 11: 71,218,367 Y103H probably benign Het
Nodal A G 10: 61,423,680 N299D probably damaging Het
Notch1 T C 2: 26,459,575 T2518A probably benign Het
Nr2e1 A C 10: 42,572,952 S97A probably benign Het
Nuak1 A T 10: 84,374,723 S500R probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Nyap1 T C 5: 137,737,913 E104G probably benign Het
Olfr401 C T 11: 74,121,700 T137I probably benign Het
Olfr670 T A 7: 104,959,997 H245L probably damaging Het
Palld T C 8: 61,877,073 T257A probably benign Het
Pcnx4 C T 12: 72,556,269 P435L probably damaging Het
Piezo1 T C 8: 122,482,014 T2538A unknown Het
Plagl1 T C 10: 13,128,128 L380P unknown Het
Polrmt G T 10: 79,740,581 Q514K probably benign Het
Psg17 T G 7: 18,819,926 D133A probably benign Het
Rab3b G A 4: 108,940,706 D185N probably benign Het
Ranbp2 T A 10: 58,455,914 S248T probably benign Het
Rdh10 C A 1: 16,129,206 A212D probably damaging Het
Rinl A G 7: 28,795,664 H154R Het
Selenbp1 T C 3: 94,944,103 M389T probably benign Het
Serpina1c T A 12: 103,896,141 H305L possibly damaging Het
Sh3rf2 T A 18: 42,149,681 S467T Het
Sipa1l1 A G 12: 82,396,561 D875G probably benign Het
Slc10a6 A T 5: 103,628,934 V100D probably damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Slc20a2 T C 8: 22,540,431 F168L probably benign Het
Slc25a1 A T 16: 17,927,244 probably null Het
Slc5a12 A G 2: 110,640,897 S495G probably benign Het
Smpdl3a A G 10: 57,800,932 D42G possibly damaging Het
Spag16 G C 1: 70,381,300 L482F probably damaging Het
Susd5 G A 9: 114,096,221 G391R probably damaging Het
Sync G T 4: 129,293,825 A217S Het
Tha1 T A 11: 117,868,686 N326Y probably damaging Het
Tjp1 A T 7: 65,302,816 F1590Y probably benign Het
Tle4 T C 19: 14,468,219 N221S probably benign Het
Tln1 T C 4: 43,536,024 T2054A probably damaging Het
Ttc30a1 A T 2: 75,980,079 Y553* probably null Het
Ttll4 A G 1: 74,679,790 K267E probably benign Het
Usp32 C T 11: 85,022,292 G930D probably damaging Het
Vmn2r75 T C 7: 86,164,239 N452D probably damaging Het
Vmn2r81 T C 10: 79,268,194 L217P possibly damaging Het
Wnt2 T A 6: 18,030,398 probably benign Het
Zfp459 C T 13: 67,408,616 S116N probably benign Het
Zfp981 C A 4: 146,537,953 T445N possibly damaging Het
Other mutations in Adck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Adck1 APN 12 88368422 missense probably benign 0.00
IGL00822:Adck1 APN 12 88455516 missense probably damaging 0.99
IGL01370:Adck1 APN 12 88456733 splice site probably benign
IGL01480:Adck1 APN 12 88456865 nonsense probably null
IGL01994:Adck1 APN 12 88431156 missense possibly damaging 0.50
IGL02089:Adck1 APN 12 88446710 missense probably damaging 0.96
IGL03058:Adck1 APN 12 88459130 missense probably benign
IGL03196:Adck1 APN 12 88431115 missense probably damaging 1.00
IGL03307:Adck1 APN 12 88459053 missense possibly damaging 0.94
full-figured UTSW 12 88441117 missense possibly damaging 0.63
0152:Adck1 UTSW 12 88431151 missense probably benign 0.03
R0107:Adck1 UTSW 12 88446656 missense possibly damaging 0.62
R0164:Adck1 UTSW 12 88455510 missense probably damaging 0.99
R0164:Adck1 UTSW 12 88455510 missense probably damaging 0.99
R0179:Adck1 UTSW 12 88459172 missense possibly damaging 0.91
R0505:Adck1 UTSW 12 88371691 splice site probably benign
R0561:Adck1 UTSW 12 88368434 missense possibly damaging 0.49
R0831:Adck1 UTSW 12 88368348 start codon destroyed probably null 1.00
R1005:Adck1 UTSW 12 88402102 missense probably damaging 0.98
R1524:Adck1 UTSW 12 88402084 missense probably damaging 1.00
R2016:Adck1 UTSW 12 88461092 missense probably damaging 1.00
R4438:Adck1 UTSW 12 88431150 nonsense probably null
R4745:Adck1 UTSW 12 88402179 splice site probably null
R4827:Adck1 UTSW 12 88446719 missense probably benign 0.06
R4859:Adck1 UTSW 12 88441095 missense probably benign 0.02
R4885:Adck1 UTSW 12 88441095 missense probably benign 0.02
R4921:Adck1 UTSW 12 88441138 missense probably benign 0.10
R5383:Adck1 UTSW 12 88455603 missense probably benign 0.04
R5958:Adck1 UTSW 12 88459052 missense probably benign 0.33
R6028:Adck1 UTSW 12 88402132 missense probably benign
R6199:Adck1 UTSW 12 88441117 missense possibly damaging 0.63
R6317:Adck1 UTSW 12 88402151 missense probably damaging 1.00
R6616:Adck1 UTSW 12 88461188 missense unknown
R6715:Adck1 UTSW 12 88459080 missense probably damaging 1.00
R6915:Adck1 UTSW 12 88455620 missense probably damaging 1.00
R7295:Adck1 UTSW 12 88431045 missense probably damaging 1.00
R7387:Adck1 UTSW 12 88461052 missense probably benign
R7520:Adck1 UTSW 12 88459205 critical splice donor site probably null
R7562:Adck1 UTSW 12 88368433 missense possibly damaging 0.77
R7745:Adck1 UTSW 12 88456800 missense probably benign
R7759:Adck1 UTSW 12 88402117 missense possibly damaging 0.65
R8092:Adck1 UTSW 12 88461061 missense possibly damaging 0.68
R8336:Adck1 UTSW 12 88368479 missense probably damaging 1.00
R9443:Adck1 UTSW 12 88371780 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTAGAACACAAGGCACCTG -3'
(R):5'- GCTGACATGCCTGCATTTCG -3'

Sequencing Primer
(F):5'- TATTAGGTGCCACGCTAAGC -3'
(R):5'- TCGATATATGTGAGCACGCC -3'
Posted On 2022-01-20