Incidental Mutation 'R9145:Cts3'
ID 694599
Institutional Source Beutler Lab
Gene Symbol Cts3
Ensembl Gene ENSMUSG00000074870
Gene Name cathepsin 3
Synonyms 1600000I23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R9145 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 61564630-61570127 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 61564986 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 307 (Y307H)
Ref Sequence ENSEMBL: ENSMUSP00000153399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054702] [ENSMUST00000223815] [ENSMUST00000224855] [ENSMUST00000225902]
AlphaFold Q91ZD5
Predicted Effect probably benign
Transcript: ENSMUST00000054702
AA Change: Y307H

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000058359
Gene: ENSMUSG00000074870
AA Change: Y307H

DomainStartEndE-ValueType
Inhibitor_I29 29 88 2.48e-24 SMART
Pept_C1 114 331 1.33e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223815
AA Change: Y307H

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224050
Predicted Effect probably benign
Transcript: ENSMUST00000224855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225515
Predicted Effect probably benign
Transcript: ENSMUST00000225902
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,559,069 H720L probably benign Het
Abca15 T C 7: 120,388,165 Y1225H probably benign Het
Adck1 C A 12: 88,368,423 N26K probably benign Het
Adcy3 A G 12: 4,195,208 D382G probably damaging Het
Ahi1 T A 10: 21,000,589 C800S probably benign Het
Ahnak G T 19: 9,014,923 V4524L probably benign Het
Apol11a C T 15: 77,513,578 A43V probably benign Het
Arid1a T C 4: 133,693,903 M479V unknown Het
Atp13a2 T A 4: 140,996,745 C324S probably damaging Het
C2cd2 T G 16: 97,876,286 T413P probably damaging Het
Cct5 A C 15: 31,590,961 D531E Het
Chst1 A T 2: 92,614,178 I332F probably damaging Het
Col12a1 A T 9: 79,620,062 V2662D probably benign Het
D630023F18Rik G A 1: 65,121,212 probably benign Het
Dhx9 A G 1: 153,461,080 I807T probably damaging Het
Doxl2 C A 6: 48,975,956 R272S probably benign Het
Exoc3l4 T C 12: 111,422,152 L25P probably benign Het
Ggcx T A 6: 72,425,922 C288S probably benign Het
Gjb3 A G 4: 127,326,347 Y131H probably damaging Het
Hdhd3 A G 4: 62,499,337 S201P probably benign Het
Helz2 A T 2: 181,240,055 V315E probably damaging Het
Hsp90aa1 A G 12: 110,696,250 probably null Het
Il12a C T 3: 68,691,542 R19W unknown Het
Isoc1 C T 18: 58,673,275 A219V possibly damaging Het
Jup T A 11: 100,378,298 T430S probably benign Het
Klra5 C T 6: 129,909,948 C39Y probably benign Het
Map4 A T 9: 110,026,200 Q131L probably damaging Het
Mau2 T A 8: 70,027,515 K314M probably damaging Het
Mga A G 2: 119,964,012 M2726V probably benign Het
Mgme1 G A 2: 144,272,485 probably null Het
Msrb2 A G 2: 19,394,255 E143G probably benign Het
Muc5b G T 7: 141,857,613 C1432F unknown Het
Naglu T C 11: 101,071,114 Y138H probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nlrp1b A G 11: 71,218,367 Y103H probably benign Het
Nodal A G 10: 61,423,680 N299D probably damaging Het
Notch1 T C 2: 26,459,575 T2518A probably benign Het
Nr2e1 A C 10: 42,572,952 S97A probably benign Het
Nuak1 A T 10: 84,374,723 S500R probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Nyap1 T C 5: 137,737,913 E104G probably benign Het
Olfr401 C T 11: 74,121,700 T137I probably benign Het
Olfr670 T A 7: 104,959,997 H245L probably damaging Het
Palld T C 8: 61,877,073 T257A probably benign Het
Pcnx4 C T 12: 72,556,269 P435L probably damaging Het
Piezo1 T C 8: 122,482,014 T2538A unknown Het
Plagl1 T C 10: 13,128,128 L380P unknown Het
Polrmt G T 10: 79,740,581 Q514K probably benign Het
Psg17 T G 7: 18,819,926 D133A probably benign Het
Rab3b G A 4: 108,940,706 D185N probably benign Het
Ranbp2 T A 10: 58,455,914 S248T probably benign Het
Rdh10 C A 1: 16,129,206 A212D probably damaging Het
Rinl A G 7: 28,795,664 H154R Het
Selenbp1 T C 3: 94,944,103 M389T probably benign Het
Serpina1c T A 12: 103,896,141 H305L possibly damaging Het
Sh3rf2 T A 18: 42,149,681 S467T Het
Sipa1l1 A G 12: 82,396,561 D875G probably benign Het
Slc10a6 A T 5: 103,628,934 V100D probably damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Slc20a2 T C 8: 22,540,431 F168L probably benign Het
Slc25a1 A T 16: 17,927,244 probably null Het
Slc5a12 A G 2: 110,640,897 S495G probably benign Het
Smpdl3a A G 10: 57,800,932 D42G possibly damaging Het
Spag16 G C 1: 70,381,300 L482F probably damaging Het
Susd5 G A 9: 114,096,221 G391R probably damaging Het
Sync G T 4: 129,293,825 A217S Het
Tha1 T A 11: 117,868,686 N326Y probably damaging Het
Tjp1 A T 7: 65,302,816 F1590Y probably benign Het
Tle4 T C 19: 14,468,219 N221S probably benign Het
Tln1 T C 4: 43,536,024 T2054A probably damaging Het
Ttc30a1 A T 2: 75,980,079 Y553* probably null Het
Ttll4 A G 1: 74,679,790 K267E probably benign Het
Usp32 C T 11: 85,022,292 G930D probably damaging Het
Vmn2r75 T C 7: 86,164,239 N452D probably damaging Het
Vmn2r81 T C 10: 79,268,194 L217P possibly damaging Het
Wnt2 T A 6: 18,030,398 probably benign Het
Zfp459 C T 13: 67,408,616 S116N probably benign Het
Zfp981 C A 4: 146,537,953 T445N possibly damaging Het
Other mutations in Cts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Cts3 APN 13 61568174 missense probably damaging 0.98
IGL02662:Cts3 APN 13 61568057 missense probably damaging 1.00
R0455:Cts3 UTSW 13 61568210 unclassified probably benign
R1673:Cts3 UTSW 13 61567554 nonsense probably null
R1793:Cts3 UTSW 13 61568153 missense probably benign 0.00
R2403:Cts3 UTSW 13 61564992 missense probably damaging 1.00
R3897:Cts3 UTSW 13 61564986 missense probably benign 0.04
R4012:Cts3 UTSW 13 61568054 critical splice donor site probably null
R4052:Cts3 UTSW 13 61568721 missense probably benign 0.27
R4669:Cts3 UTSW 13 61566823 missense probably benign 0.01
R4907:Cts3 UTSW 13 61566820 missense probably benign 0.01
R5121:Cts3 UTSW 13 61567595 missense probably benign 0.09
R5572:Cts3 UTSW 13 61564968 missense probably damaging 0.99
R5774:Cts3 UTSW 13 61568370 missense probably damaging 1.00
R5796:Cts3 UTSW 13 61568703 missense probably damaging 1.00
R5797:Cts3 UTSW 13 61568392 missense probably damaging 1.00
R6159:Cts3 UTSW 13 61566841 missense probably damaging 1.00
R6226:Cts3 UTSW 13 61568721 missense probably benign 0.27
R7346:Cts3 UTSW 13 61567620 missense probably benign 0.00
R7642:Cts3 UTSW 13 61568775 missense probably benign 0.02
R7948:Cts3 UTSW 13 61566049 missense probably benign 0.04
R8060:Cts3 UTSW 13 61566766 missense probably damaging 1.00
R9127:Cts3 UTSW 13 61567421 nonsense probably null
R9218:Cts3 UTSW 13 61568769 missense possibly damaging 0.74
R9707:Cts3 UTSW 13 61566835 missense possibly damaging 0.95
R9717:Cts3 UTSW 13 61564985 missense probably benign 0.00
Z1177:Cts3 UTSW 13 61568747 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCAGTGACTGCAGTGTCTC -3'
(R):5'- CATTATTTCTGAGCCACACATGTG -3'

Sequencing Primer
(F):5'- AGTGACTGCAGTGTCTCATATTCAC -3'
(R):5'- TGAGATTTGTCTTATCATTTCCTTGC -3'
Posted On 2022-01-20