Mutagenetix > Incidental Mutation

Incidental Mutation 'R9146:Trip12'

694612

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9146 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 84794160 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 89 (A89E)

Ref Sequence

ENSEMBL: ENSMUSP00000140267 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894] [ENSMUST00000187818] [ENSMUST00000189496] [ENSMUST00000190067]

AlphaFold

G5E870

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027421
AA Change: A89E

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: A89E

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000185909
AA Change: A131E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219
AA Change: A131E

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000186465
AA Change: A89E

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: A89E

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000186648
AA Change: A89E

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: A89E

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000186894
AA Change: A89E

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219
AA Change: A89E

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	3e-20	SMART
PDB:1WA5\|B	447	641	7e-6	PDB
Blast:ARM	476	516	6e-6	BLAST
WWE	764	839	6.9e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187818

SMART Domains

Protein: ENSMUSP00000140917
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000189496
AA Change: A131E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139682
Gene: ENSMUSG00000026219
AA Change: A131E

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190067
AA Change: A89E

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140817
Gene: ENSMUSG00000026219
AA Change: A89E

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190464

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ache	G	A	5: 137,290,815	G261D	probably damaging	Het
Adgrv1	T	A	13: 81,413,172	T5408S	probably benign	Het
Aff3	T	C	1: 38,320,119	N362D	probably benign	Het
Aff4	A	G	11: 53,408,136	N956S	probably benign	Het
Alg10b	A	G	15: 90,228,198	E415G	probably damaging	Het
Ate1	T	C	7: 130,467,292	Y415C	probably damaging	Het
Cage1	T	C	13: 38,023,029	D280G	probably benign	Het
Catsperg1	G	C	7: 29,210,487	P72R	probably benign	Het
Cep290	A	G	10: 100,541,803	E1565G	probably benign	Het
Csmd1	T	A	8: 15,998,832	Y2290F	probably benign	Het
Cyp2c39	A	T	19: 39,538,900	H230L		Het
Efhb	A	G	17: 53,462,616	S222P	probably benign	Het
Emilin2	G	A	17: 71,274,336	T465M	probably damaging	Het
Ep400	A	T	5: 110,701,769	Y1431*	probably null	Het
Gm10912	T	C	2: 104,066,708	V64A	possibly damaging	Het
Gpat2	T	C	2: 127,431,286	S197P	possibly damaging	Het
Hc	T	C	2: 35,034,559	Y452C	probably damaging	Het
Hectd4	T	C	5: 121,349,034	I3364T	probably benign	Het
Hjurp	TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT	TCT	1: 88,266,278		probably benign	Het
Hmcn1	G	A	1: 150,598,390	T4767M	probably benign	Het
Hspa4l	A	G	3: 40,781,669	D595G	probably benign	Het
Kdm1a	G	T	4: 136,602,428	T53K	unknown	Het
Kirrel	T	C	3: 87,095,708	D126G	probably damaging	Het
Kit	T	A	5: 75,649,645	D822E	probably damaging	Het
Kiz	C	T	2: 146,863,820	T100M	probably benign	Het
Kmt2a	T	A	9: 44,814,641	K3663*	probably null	Het
Krt8	T	A	15: 101,998,935	I238F	probably damaging	Het
Ky	C	T	9: 102,542,206	P471S		Het
Lca5l	T	C	16: 96,159,798	E493G	probably damaging	Het
Lrrc2	C	T	9: 110,979,514	T273I	probably damaging	Het
Mcoln2	T	C	3: 146,163,548	S31P	probably benign	Het
Mmp1a	A	G	9: 7,464,997	D77G	probably damaging	Het
Mrgprb8	T	A	7: 48,389,452	C290*	probably null	Het
Nfe2l3	G	T	6: 51,433,192	A96S	probably damaging	Het
Notch2	A	G	3: 98,104,538	D624G	probably damaging	Het
Nup98	C	A	7: 102,138,830	R1011L	probably benign	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Olfr666	T	A	7: 104,893,245	I128F	probably damaging	Het
Olfr789	T	C	10: 129,487,523	V171A	possibly damaging	Het
Pcdh10	G	A	3: 45,379,916	A222T	probably benign	Het
Piezo1	G	A	8: 122,500,263	H420Y		Het
Pik3r1	C	A	13: 101,688,628		probably benign	Het
Plcb1	T	A	2: 135,340,695	Y642N	probably damaging	Het
Ralgapa2	T	A	2: 146,342,332	H1538L	probably benign	Het
Raph1	A	G	1: 60,518,978		probably null	Het
Rnf213	T	C	11: 119,443,673	F3237S		Het
Sctr	A	G	1: 120,054,280	D286G	probably damaging	Het
Smyd3	A	G	1: 179,092,964	S202P	probably damaging	Het
Ssh2	G	A	11: 77,437,676	G356E	probably damaging	Het
Stat3	A	T	11: 100,893,666	S629R	probably benign	Het
Stc2	A	G	11: 31,367,847	V58A	probably damaging	Het
Tcerg1l	T	A	7: 138,229,859	D463V	probably damaging	Het
Tctn1	A	G	5: 122,251,682	V259A	possibly damaging	Het
Tmem248	A	G	5: 130,232,010	T139A	probably benign	Het
Vmn2r54	C	T	7: 12,632,720	V96I	probably benign	Het
Vmn2r79	C	T	7: 87,001,473	Q156*	probably null	Het
Zfp831	C	A	2: 174,645,668	T712N	possibly damaging	Het
Zfy1	A	T	Y: 726,033	H577Q	possibly damaging	Het
Zscan4-ps2	T	G	7: 11,517,752	S238R	possibly damaging	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0090:Trip12	UTSW	1	84732136	splice site	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0627:Trip12	UTSW	1	84768597	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1455:Trip12	UTSW	1	84759100	missense	probably benign	0.01
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1702:Trip12	UTSW	1	84745063	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1847:Trip12	UTSW	1	84749269	missense	probably damaging	1.00
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1866:Trip12	UTSW	1	84745060	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1935:Trip12	UTSW	1	84794101	missense	possibly damaging	0.46
R1950:Trip12	UTSW	1	84760801	missense	probably damaging	1.00
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4394:Trip12	UTSW	1	84725741	missense	probably damaging	1.00
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R4859:Trip12	UTSW	1	84793810	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7355:Trip12	UTSW	1	84814883	missense	probably damaging	1.00
R7361:Trip12	UTSW	1	84750442	missense	probably damaging	0.98
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7818:Trip12	UTSW	1	84760806	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8221:Trip12	UTSW	1	84766050	missense	possibly damaging	0.80
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8771:Trip12	UTSW	1	84743297	unclassified	probably benign
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9236:Trip12	UTSW	1	84725829	missense	probably damaging	1.00
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
R9516:Trip12	UTSW	1	84757494	missense	probably damaging	1.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTTGATTCGGACCCAGAAC -3'
(R):5'- GAAGCTGCAGTTCATCATCTG -3'

Sequencing Primer
(F):5'- ACTTTTAACACAAGAACTCTCTGTCC -3'
(R):5'- TGCTGTCATAGTTCCACAACCAGAG -3'

Posted On

2022-01-20