Incidental Mutation 'R9146:Hjurp'
ID 694613
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene Name Holliday junction recognition protein
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock # R9146 (G1)
Quality Score 217.468
Status Validated
Chromosome 1
Chromosomal Location 88262471-88277633 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT to TCT at 88266278 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127446
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache G A 5: 137,290,815 G261D probably damaging Het
Adgrv1 T A 13: 81,413,172 T5408S probably benign Het
Aff3 T C 1: 38,320,119 N362D probably benign Het
Aff4 A G 11: 53,408,136 N956S probably benign Het
Alg10b A G 15: 90,228,198 E415G probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
Cage1 T C 13: 38,023,029 D280G probably benign Het
Catsperg1 G C 7: 29,210,487 P72R probably benign Het
Cep290 A G 10: 100,541,803 E1565G probably benign Het
Csmd1 T A 8: 15,998,832 Y2290F probably benign Het
Cyp2c39 A T 19: 39,538,900 H230L Het
Efhb A G 17: 53,462,616 S222P probably benign Het
Emilin2 G A 17: 71,274,336 T465M probably damaging Het
Ep400 A T 5: 110,701,769 Y1431* probably null Het
Gm10912 T C 2: 104,066,708 V64A possibly damaging Het
Gpat2 T C 2: 127,431,286 S197P possibly damaging Het
Hc T C 2: 35,034,559 Y452C probably damaging Het
Hectd4 T C 5: 121,349,034 I3364T probably benign Het
Hmcn1 G A 1: 150,598,390 T4767M probably benign Het
Hspa4l A G 3: 40,781,669 D595G probably benign Het
Kdm1a G T 4: 136,602,428 T53K unknown Het
Kirrel T C 3: 87,095,708 D126G probably damaging Het
Kit T A 5: 75,649,645 D822E probably damaging Het
Kiz C T 2: 146,863,820 T100M probably benign Het
Kmt2a T A 9: 44,814,641 K3663* probably null Het
Krt8 T A 15: 101,998,935 I238F probably damaging Het
Ky C T 9: 102,542,206 P471S Het
Lca5l T C 16: 96,159,798 E493G probably damaging Het
Lrrc2 C T 9: 110,979,514 T273I probably damaging Het
Mcoln2 T C 3: 146,163,548 S31P probably benign Het
Mmp1a A G 9: 7,464,997 D77G probably damaging Het
Mrgprb8 T A 7: 48,389,452 C290* probably null Het
Nfe2l3 G T 6: 51,433,192 A96S probably damaging Het
Notch2 A G 3: 98,104,538 D624G probably damaging Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr666 T A 7: 104,893,245 I128F probably damaging Het
Olfr789 T C 10: 129,487,523 V171A possibly damaging Het
Pcdh10 G A 3: 45,379,916 A222T probably benign Het
Piezo1 G A 8: 122,500,263 H420Y Het
Pik3r1 C A 13: 101,688,628 probably benign Het
Plcb1 T A 2: 135,340,695 Y642N probably damaging Het
Ralgapa2 T A 2: 146,342,332 H1538L probably benign Het
Raph1 A G 1: 60,518,978 probably null Het
Rnf213 T C 11: 119,443,673 F3237S Het
Sctr A G 1: 120,054,280 D286G probably damaging Het
Smyd3 A G 1: 179,092,964 S202P probably damaging Het
Ssh2 G A 11: 77,437,676 G356E probably damaging Het
Stat3 A T 11: 100,893,666 S629R probably benign Het
Stc2 A G 11: 31,367,847 V58A probably damaging Het
Tcerg1l T A 7: 138,229,859 D463V probably damaging Het
Tctn1 A G 5: 122,251,682 V259A possibly damaging Het
Tmem248 A G 5: 130,232,010 T139A probably benign Het
Trip12 G T 1: 84,794,160 A89E possibly damaging Het
Vmn2r54 C T 7: 12,632,720 V96I probably benign Het
Vmn2r79 C T 7: 87,001,473 Q156* probably null Het
Zfp831 C A 2: 174,645,668 T712N possibly damaging Het
Zfy1 A T Y: 726,033 H577Q possibly damaging Het
Zscan4-ps2 T G 7: 11,517,752 S238R possibly damaging Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88270269 missense probably benign 0.04
IGL03099:Hjurp APN 1 88266289 missense probably benign 0.09
BB003:Hjurp UTSW 1 88266278 utr 3 prime probably benign
IGL03097:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88266280 utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266046 missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266561 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266616 missense probably benign 0.04
PIT4378001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R0053:Hjurp UTSW 1 88277215 splice site probably benign
R0371:Hjurp UTSW 1 88277368 splice site probably benign
R0442:Hjurp UTSW 1 88266524 nonsense probably null
R0762:Hjurp UTSW 1 88277215 splice site probably benign
R0928:Hjurp UTSW 1 88266524 nonsense probably null
R1333:Hjurp UTSW 1 88266046 missense probably damaging 0.98
R1342:Hjurp UTSW 1 88277368 splice site probably benign
R1364:Hjurp UTSW 1 88266525 frame shift probably null
R1496:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88266121 missense probably benign 0.03
R1905:Hjurp UTSW 1 88266616 missense probably benign 0.04
R1965:Hjurp UTSW 1 88266524 nonsense probably null
R1992:Hjurp UTSW 1 88266524 nonsense probably null
R2002:Hjurp UTSW 1 88266524 nonsense probably null
R2023:Hjurp UTSW 1 88266524 nonsense probably null
R2024:Hjurp UTSW 1 88266524 nonsense probably null
R2332:Hjurp UTSW 1 88277215 splice site probably benign
R2420:Hjurp UTSW 1 88266524 nonsense probably null
R2422:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R2869:Hjurp UTSW 1 88266524 nonsense probably null
R2870:Hjurp UTSW 1 88266524 nonsense probably null
R2871:Hjurp UTSW 1 88266524 nonsense probably null
R2872:Hjurp UTSW 1 88266524 nonsense probably null
R3019:Hjurp UTSW 1 88266524 nonsense probably null
R3021:Hjurp UTSW 1 88266524 nonsense probably null
R3150:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R3411:Hjurp UTSW 1 88266524 nonsense probably null
R3552:Hjurp UTSW 1 88266524 nonsense probably null
R3704:Hjurp UTSW 1 88277215 splice site probably benign
R3730:Hjurp UTSW 1 88266524 nonsense probably null
R3733:Hjurp UTSW 1 88266524 nonsense probably null
R3764:Hjurp UTSW 1 88266524 nonsense probably null
R3799:Hjurp UTSW 1 88277215 splice site probably benign
R3819:Hjurp UTSW 1 88277215 splice site probably benign
R3857:Hjurp UTSW 1 88266524 nonsense probably null
R3930:Hjurp UTSW 1 88266524 nonsense probably null
R3952:Hjurp UTSW 1 88277215 splice site probably benign
R4090:Hjurp UTSW 1 88277215 splice site probably benign
R4159:Hjurp UTSW 1 88277215 splice site probably benign
R4207:Hjurp UTSW 1 88277215 splice site probably benign
R4322:Hjurp UTSW 1 88277215 splice site probably benign
R4391:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4392:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4397:Hjurp UTSW 1 88266524 nonsense probably null
R4700:Hjurp UTSW 1 88266524 nonsense probably null
R4808:Hjurp UTSW 1 88277215 splice site probably benign
R4900:Hjurp UTSW 1 88266524 nonsense probably null
R4901:Hjurp UTSW 1 88266524 nonsense probably null
R5023:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88266524 nonsense probably null
R5123:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88266524 nonsense probably null
R5300:Hjurp UTSW 1 88266524 nonsense probably null
R5318:Hjurp UTSW 1 88266524 nonsense probably null
R5370:Hjurp UTSW 1 88266524 nonsense probably null
R5410:Hjurp UTSW 1 88266524 nonsense probably null
R5445:Hjurp UTSW 1 88266316 missense probably benign 0.43
R5457:Hjurp UTSW 1 88266525 frame shift probably null
R5497:Hjurp UTSW 1 88266320 missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88266524 nonsense probably null
R5561:Hjurp UTSW 1 88266524 nonsense probably null
R5615:Hjurp UTSW 1 88266524 nonsense probably null
R5661:Hjurp UTSW 1 88277215 splice site probably benign
R5722:Hjurp UTSW 1 88266524 nonsense probably null
R6087:Hjurp UTSW 1 88266524 nonsense probably null
R6089:Hjurp UTSW 1 88266524 nonsense probably null
R6090:Hjurp UTSW 1 88266524 nonsense probably null
R6125:Hjurp UTSW 1 88266524 nonsense probably null
R6175:Hjurp UTSW 1 88266524 nonsense probably null
R6362:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88266524 nonsense probably null
R7016:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R7016:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7045:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7179:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7200:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7463:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R7912:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R8215:Hjurp UTSW 1 88266524 nonsense probably null
R8968:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R9038:Hjurp UTSW 1 88266524 nonsense probably null
R9115:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R9133:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R9221:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R9475:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R9482:Hjurp UTSW 1 88266274 utr 3 prime probably benign
R9565:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R9599:Hjurp UTSW 1 88266278 utr 3 prime probably benign
V5622:Hjurp UTSW 1 88277525 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGTCCTTCTGCGGCATCATC -3'
(R):5'- GACCTTTGCAATGTGACAATCAG -3'

Sequencing Primer
(F):5'- CTTCTGCGGCATCATCTGGAG -3'
(R):5'- GCAATGTGACAATCAGCGATTTG -3'
Posted On 2022-01-20