Incidental Mutation 'R9146:Plcb1'
ID 694620
Institutional Source Beutler Lab
Gene Symbol Plcb1
Ensembl Gene ENSMUSG00000051177
Gene Name phospholipase C, beta 1
Synonyms 3110043I21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock # R9146 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 134786067-135475258 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 135340695 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 642 (Y642N)
Ref Sequence ENSEMBL: ENSMUSP00000105743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]
AlphaFold Q9Z1B3
Predicted Effect probably damaging
Transcript: ENSMUST00000070724
AA Change: Y642N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: Y642N

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 2.2e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.3e-7 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 997 1155 1.9e-64 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110116
AA Change: Y642N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: Y642N

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 4.1e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1176 2.9e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131552
AA Change: Y642N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: Y642N

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 3.9e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1148 8e-51 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache G A 5: 137,290,815 G261D probably damaging Het
Adgrv1 T A 13: 81,413,172 T5408S probably benign Het
Aff3 T C 1: 38,320,119 N362D probably benign Het
Aff4 A G 11: 53,408,136 N956S probably benign Het
Alg10b A G 15: 90,228,198 E415G probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
Cage1 T C 13: 38,023,029 D280G probably benign Het
Catsperg1 G C 7: 29,210,487 P72R probably benign Het
Cep290 A G 10: 100,541,803 E1565G probably benign Het
Csmd1 T A 8: 15,998,832 Y2290F probably benign Het
Cyp2c39 A T 19: 39,538,900 H230L Het
Efhb A G 17: 53,462,616 S222P probably benign Het
Emilin2 G A 17: 71,274,336 T465M probably damaging Het
Ep400 A T 5: 110,701,769 Y1431* probably null Het
Gm10912 T C 2: 104,066,708 V64A possibly damaging Het
Gpat2 T C 2: 127,431,286 S197P possibly damaging Het
Hc T C 2: 35,034,559 Y452C probably damaging Het
Hectd4 T C 5: 121,349,034 I3364T probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hmcn1 G A 1: 150,598,390 T4767M probably benign Het
Hspa4l A G 3: 40,781,669 D595G probably benign Het
Kdm1a G T 4: 136,602,428 T53K unknown Het
Kirrel T C 3: 87,095,708 D126G probably damaging Het
Kit T A 5: 75,649,645 D822E probably damaging Het
Kiz C T 2: 146,863,820 T100M probably benign Het
Kmt2a T A 9: 44,814,641 K3663* probably null Het
Krt8 T A 15: 101,998,935 I238F probably damaging Het
Ky C T 9: 102,542,206 P471S Het
Lca5l T C 16: 96,159,798 E493G probably damaging Het
Lrrc2 C T 9: 110,979,514 T273I probably damaging Het
Mcoln2 T C 3: 146,163,548 S31P probably benign Het
Mmp1a A G 9: 7,464,997 D77G probably damaging Het
Mrgprb8 T A 7: 48,389,452 C290* probably null Het
Nfe2l3 G T 6: 51,433,192 A96S probably damaging Het
Notch2 A G 3: 98,104,538 D624G probably damaging Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr666 T A 7: 104,893,245 I128F probably damaging Het
Olfr789 T C 10: 129,487,523 V171A possibly damaging Het
Pcdh10 G A 3: 45,379,916 A222T probably benign Het
Piezo1 G A 8: 122,500,263 H420Y Het
Pik3r1 C A 13: 101,688,628 probably benign Het
Ralgapa2 T A 2: 146,342,332 H1538L probably benign Het
Raph1 A G 1: 60,518,978 probably null Het
Rnf213 T C 11: 119,443,673 F3237S Het
Sctr A G 1: 120,054,280 D286G probably damaging Het
Smyd3 A G 1: 179,092,964 S202P probably damaging Het
Ssh2 G A 11: 77,437,676 G356E probably damaging Het
Stat3 A T 11: 100,893,666 S629R probably benign Het
Stc2 A G 11: 31,367,847 V58A probably damaging Het
Tcerg1l T A 7: 138,229,859 D463V probably damaging Het
Tctn1 A G 5: 122,251,682 V259A possibly damaging Het
Tmem248 A G 5: 130,232,010 T139A probably benign Het
Trip12 G T 1: 84,794,160 A89E possibly damaging Het
Vmn2r54 C T 7: 12,632,720 V96I probably benign Het
Vmn2r79 C T 7: 87,001,473 Q156* probably null Het
Zfp831 C A 2: 174,645,668 T712N possibly damaging Het
Zfy1 A T Y: 726,033 H577Q possibly damaging Het
Zscan4-ps2 T G 7: 11,517,752 S238R possibly damaging Het
Other mutations in Plcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Plcb1 APN 2 135251756 missense possibly damaging 0.66
IGL01152:Plcb1 APN 2 134813659 missense probably damaging 1.00
IGL01945:Plcb1 APN 2 135220791 missense probably benign 0.03
IGL01999:Plcb1 APN 2 135346318 missense probably damaging 1.00
IGL02109:Plcb1 APN 2 134786559 missense probably damaging 1.00
IGL02153:Plcb1 APN 2 135387853 missense probably benign 0.08
IGL02207:Plcb1 APN 2 135387171 missense probably damaging 1.00
IGL02566:Plcb1 APN 2 135472263 missense probably benign 0.17
IGL02590:Plcb1 APN 2 135294864 missense probably benign 0.08
IGL02640:Plcb1 APN 2 135220859 splice site probably benign
IGL02926:Plcb1 APN 2 135364762 splice site probably benign
IGL03071:Plcb1 APN 2 135387802 missense probably damaging 1.00
IGL03236:Plcb1 APN 2 135346306 missense probably damaging 1.00
IGL03252:Plcb1 APN 2 135370428 missense probably benign
IGL03387:Plcb1 APN 2 134813686 splice site probably benign
BB001:Plcb1 UTSW 2 135359693 missense probably benign 0.00
BB011:Plcb1 UTSW 2 135359693 missense probably benign 0.00
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0308:Plcb1 UTSW 2 134813614 missense probably benign 0.01
R0415:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
R0624:Plcb1 UTSW 2 135294911 missense possibly damaging 0.81
R0898:Plcb1 UTSW 2 135387143 missense possibly damaging 0.73
R1071:Plcb1 UTSW 2 135325657 missense possibly damaging 0.64
R1615:Plcb1 UTSW 2 135362444 splice site probably benign
R1617:Plcb1 UTSW 2 135337441 missense probably damaging 1.00
R1785:Plcb1 UTSW 2 135325667 nonsense probably null
R1866:Plcb1 UTSW 2 135344173 missense probably benign 0.01
R1869:Plcb1 UTSW 2 135311014 missense probably benign 0.02
R1902:Plcb1 UTSW 2 134813613 missense possibly damaging 0.93
R1938:Plcb1 UTSW 2 135386302 missense probably damaging 1.00
R2016:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2017:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2131:Plcb1 UTSW 2 135325667 nonsense probably null
R2132:Plcb1 UTSW 2 135325667 nonsense probably null
R2133:Plcb1 UTSW 2 135325667 nonsense probably null
R2164:Plcb1 UTSW 2 135346330 missense possibly damaging 0.87
R2419:Plcb1 UTSW 2 135262100 splice site probably benign
R2429:Plcb1 UTSW 2 135337442 missense probably damaging 0.99
R2508:Plcb1 UTSW 2 135260508 missense probably benign 0.27
R3161:Plcb1 UTSW 2 135335482 missense probably benign 0.03
R3870:Plcb1 UTSW 2 135325671 missense probably damaging 0.99
R4191:Plcb1 UTSW 2 135345090 missense probably damaging 1.00
R4239:Plcb1 UTSW 2 135344158 missense probably damaging 0.99
R4552:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4553:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4720:Plcb1 UTSW 2 135251747 missense possibly damaging 0.70
R4946:Plcb1 UTSW 2 135345095 missense probably benign 0.01
R5012:Plcb1 UTSW 2 135333400 missense probably null 0.97
R5151:Plcb1 UTSW 2 135262245 missense probably benign 0.28
R5320:Plcb1 UTSW 2 135252776 missense possibly damaging 0.56
R5415:Plcb1 UTSW 2 135347402 missense possibly damaging 0.67
R5523:Plcb1 UTSW 2 135260566 missense probably benign 0.08
R5568:Plcb1 UTSW 2 135370593 missense probably damaging 1.00
R5688:Plcb1 UTSW 2 135335480 missense probably benign 0.06
R5809:Plcb1 UTSW 2 135262244 missense possibly damaging 0.83
R6237:Plcb1 UTSW 2 135370566 missense possibly damaging 0.94
R6315:Plcb1 UTSW 2 135346341 missense probably benign 0.00
R6478:Plcb1 UTSW 2 135335451 missense probably damaging 1.00
R6531:Plcb1 UTSW 2 135325802 critical splice donor site probably null
R6683:Plcb1 UTSW 2 134786593 missense probably benign 0.32
R6760:Plcb1 UTSW 2 135472060 missense possibly damaging 0.50
R6947:Plcb1 UTSW 2 135386155 missense probably benign 0.08
R6976:Plcb1 UTSW 2 135262239 missense possibly damaging 0.75
R7379:Plcb1 UTSW 2 135370510 missense probably benign 0.45
R7473:Plcb1 UTSW 2 135344276 missense probably damaging 0.98
R7492:Plcb1 UTSW 2 135251764 nonsense probably null
R7498:Plcb1 UTSW 2 135262233 nonsense probably null
R7498:Plcb1 UTSW 2 135262234 missense probably damaging 0.99
R7777:Plcb1 UTSW 2 135220757 missense possibly damaging 0.51
R7924:Plcb1 UTSW 2 135359693 missense probably benign 0.00
R8061:Plcb1 UTSW 2 135346396 missense probably benign
R8099:Plcb1 UTSW 2 135251734 missense possibly damaging 0.68
R8299:Plcb1 UTSW 2 135335476 missense probably damaging 1.00
R8394:Plcb1 UTSW 2 135317790 missense probably damaging 1.00
R8439:Plcb1 UTSW 2 135250052 critical splice donor site probably null
R8549:Plcb1 UTSW 2 135364933 missense probably benign 0.00
R8693:Plcb1 UTSW 2 135252776 missense probably benign 0.00
R8750:Plcb1 UTSW 2 135335449 missense probably damaging 1.00
R8817:Plcb1 UTSW 2 135333509 intron probably benign
R8950:Plcb1 UTSW 2 135337519 missense probably damaging 1.00
R9301:Plcb1 UTSW 2 135325690 missense possibly damaging 0.96
R9311:Plcb1 UTSW 2 135347465 missense probably benign 0.00
R9459:Plcb1 UTSW 2 135322638 missense probably benign 0.03
S24628:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
X0025:Plcb1 UTSW 2 135345054 missense possibly damaging 0.87
Z1088:Plcb1 UTSW 2 135220846 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCAGCCTGTTGACAGTATTCTC -3'
(R):5'- GACTTGGGTGTCGAGCATAG -3'

Sequencing Primer
(F):5'- ACAGTATTCTCTCTGAATTTGGGG -3'
(R):5'- TCGAGCATAGGGGTGGG -3'
Posted On 2022-01-20