Incidental Mutation 'R9146:Hspa4l'
ID 694624
Institutional Source Beutler Lab
Gene Symbol Hspa4l
Ensembl Gene ENSMUSG00000025757
Gene Name heat shock protein 4 like
Synonyms Osp94, APG-1, 94kDa
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R9146 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 40699814-40750538 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40736101 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 595 (D595G)
Ref Sequence ENSEMBL: ENSMUSP00000145468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108086] [ENSMUST00000203353] [ENSMUST00000204702]
AlphaFold P48722
Predicted Effect probably damaging
Transcript: ENSMUST00000108086
AA Change: D574G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103721
Gene: ENSMUSG00000025757
AA Change: D574G

DomainStartEndE-ValueType
Pfam:HSP70 11 673 2.1e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203353
SMART Domains Protein: ENSMUSP00000144787
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 3 570 6.2e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204702
AA Change: D595G

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000145468
Gene: ENSMUSG00000025757
AA Change: D595G

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is heat shock inducible and may act as a chaperone. The encoded protein can protect the heat-shocked cell against the harmful effects of aggregated proteins. This gene is highly expressed in leukemia cells and may be a good target for therapeutic intervention. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased incidence of male infertility, due to reduced number of mature sperm and reduced sperm motility, and hydronephrosis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache G A 5: 137,289,077 (GRCm39) G261D probably damaging Het
Adgrv1 T A 13: 81,561,291 (GRCm39) T5408S probably benign Het
Aff3 T C 1: 38,359,200 (GRCm39) N362D probably benign Het
Aff4 A G 11: 53,298,963 (GRCm39) N956S probably benign Het
Alg10b A G 15: 90,112,401 (GRCm39) E415G probably damaging Het
Ate1 T C 7: 130,069,022 (GRCm39) Y415C probably damaging Het
Cage1 T C 13: 38,207,005 (GRCm39) D280G probably benign Het
Catsperg1 G C 7: 28,909,912 (GRCm39) P72R probably benign Het
Cep290 A G 10: 100,377,665 (GRCm39) E1565G probably benign Het
Csmd1 T A 8: 16,048,832 (GRCm39) Y2290F probably benign Het
Cyp2c39 A T 19: 39,527,344 (GRCm39) H230L Het
Efhb A G 17: 53,769,644 (GRCm39) S222P probably benign Het
Emilin2 G A 17: 71,581,331 (GRCm39) T465M probably damaging Het
Ep400 A T 5: 110,849,635 (GRCm39) Y1431* probably null Het
Gm10912 T C 2: 103,897,053 (GRCm39) V64A possibly damaging Het
Gpat2 T C 2: 127,273,206 (GRCm39) S197P possibly damaging Het
Hc T C 2: 34,924,571 (GRCm39) Y452C probably damaging Het
Hectd4 T C 5: 121,487,097 (GRCm39) I3364T probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,194,000 (GRCm39) probably benign Het
Hmcn1 G A 1: 150,474,141 (GRCm39) T4767M probably benign Het
Kdm1a G T 4: 136,329,739 (GRCm39) T53K unknown Het
Kirrel1 T C 3: 87,003,015 (GRCm39) D126G probably damaging Het
Kit T A 5: 75,810,305 (GRCm39) D822E probably damaging Het
Kiz C T 2: 146,705,740 (GRCm39) T100M probably benign Het
Kmt2a T A 9: 44,725,938 (GRCm39) K3663* probably null Het
Krt8 T A 15: 101,907,370 (GRCm39) I238F probably damaging Het
Ky C T 9: 102,419,405 (GRCm39) P471S Het
Lca5l T C 16: 95,960,998 (GRCm39) E493G probably damaging Het
Lrrc2 C T 9: 110,808,582 (GRCm39) T273I probably damaging Het
Mcoln2 T C 3: 145,869,303 (GRCm39) S31P probably benign Het
Mmp1a A G 9: 7,464,997 (GRCm39) D77G probably damaging Het
Mrgprb8 T A 7: 48,039,200 (GRCm39) C290* probably null Het
Nfe2l3 G T 6: 51,410,172 (GRCm39) A96S probably damaging Het
Notch2 A G 3: 98,011,854 (GRCm39) D624G probably damaging Het
Nup98 C A 7: 101,788,037 (GRCm39) R1011L probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Or52n2 T A 7: 104,542,452 (GRCm39) I128F probably damaging Het
Or6c7 T C 10: 129,323,392 (GRCm39) V171A possibly damaging Het
Pcdh10 G A 3: 45,334,351 (GRCm39) A222T probably benign Het
Piezo1 G A 8: 123,227,002 (GRCm39) H420Y Het
Pik3r1 C A 13: 101,825,136 (GRCm39) probably benign Het
Plcb1 T A 2: 135,182,615 (GRCm39) Y642N probably damaging Het
Ralgapa2 T A 2: 146,184,252 (GRCm39) H1538L probably benign Het
Raph1 A G 1: 60,558,137 (GRCm39) probably null Het
Rnf213 T C 11: 119,334,499 (GRCm39) F3237S Het
Sctr A G 1: 119,982,010 (GRCm39) D286G probably damaging Het
Smyd3 A G 1: 178,920,529 (GRCm39) S202P probably damaging Het
Ssh2 G A 11: 77,328,502 (GRCm39) G356E probably damaging Het
Stat3 A T 11: 100,784,492 (GRCm39) S629R probably benign Het
Stc2 A G 11: 31,317,847 (GRCm39) V58A probably damaging Het
Tcerg1l T A 7: 137,831,588 (GRCm39) D463V probably damaging Het
Tctn1 A G 5: 122,389,745 (GRCm39) V259A possibly damaging Het
Tmem248 A G 5: 130,260,851 (GRCm39) T139A probably benign Het
Trip12 G T 1: 84,771,881 (GRCm39) A89E possibly damaging Het
Vmn2r54 C T 7: 12,366,647 (GRCm39) V96I probably benign Het
Vmn2r79 C T 7: 86,650,681 (GRCm39) Q156* probably null Het
Zfp831 C A 2: 174,487,461 (GRCm39) T712N possibly damaging Het
Zfy1 A T Y: 726,033 (GRCm39) H577Q possibly damaging Het
Zscan4-ps2 T G 7: 11,251,679 (GRCm39) S238R possibly damaging Het
Other mutations in Hspa4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Hspa4l APN 3 40,707,657 (GRCm39) nonsense probably null
IGL02605:Hspa4l APN 3 40,736,055 (GRCm39) missense probably benign 0.20
IGL02719:Hspa4l APN 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R0281:Hspa4l UTSW 3 40,739,840 (GRCm39) splice site probably benign
R0398:Hspa4l UTSW 3 40,711,429 (GRCm39) splice site probably benign
R0487:Hspa4l UTSW 3 40,738,758 (GRCm39) missense possibly damaging 0.87
R0610:Hspa4l UTSW 3 40,733,832 (GRCm39) missense probably benign 0.01
R0760:Hspa4l UTSW 3 40,739,155 (GRCm39) nonsense probably null
R1491:Hspa4l UTSW 3 40,741,226 (GRCm39) missense probably benign 0.00
R1720:Hspa4l UTSW 3 40,736,049 (GRCm39) nonsense probably null
R1984:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R1986:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R2100:Hspa4l UTSW 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R3706:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3708:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3856:Hspa4l UTSW 3 40,739,821 (GRCm39) missense probably benign 0.29
R3874:Hspa4l UTSW 3 40,727,074 (GRCm39) missense probably damaging 1.00
R3890:Hspa4l UTSW 3 40,736,026 (GRCm39) missense possibly damaging 0.90
R4256:Hspa4l UTSW 3 40,700,435 (GRCm39) missense probably benign 0.03
R4364:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4365:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4366:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4493:Hspa4l UTSW 3 40,722,434 (GRCm39) missense possibly damaging 0.77
R4494:Hspa4l UTSW 3 40,707,636 (GRCm39) missense possibly damaging 0.86
R4954:Hspa4l UTSW 3 40,739,832 (GRCm39) critical splice donor site probably null
R4994:Hspa4l UTSW 3 40,700,081 (GRCm39) utr 5 prime probably benign
R5114:Hspa4l UTSW 3 40,700,197 (GRCm39) missense possibly damaging 0.60
R5133:Hspa4l UTSW 3 40,741,179 (GRCm39) missense possibly damaging 0.94
R5202:Hspa4l UTSW 3 40,736,001 (GRCm39) missense probably benign 0.17
R5440:Hspa4l UTSW 3 40,736,008 (GRCm39) missense probably damaging 1.00
R5635:Hspa4l UTSW 3 40,700,177 (GRCm39) missense probably damaging 1.00
R5997:Hspa4l UTSW 3 40,722,411 (GRCm39) missense probably damaging 0.99
R6012:Hspa4l UTSW 3 40,736,031 (GRCm39) missense probably benign 0.09
R6515:Hspa4l UTSW 3 40,736,014 (GRCm39) missense possibly damaging 0.82
R6589:Hspa4l UTSW 3 40,711,487 (GRCm39) missense probably damaging 0.99
R7091:Hspa4l UTSW 3 40,736,024 (GRCm39) missense probably benign 0.00
R7601:Hspa4l UTSW 3 40,738,788 (GRCm39) critical splice donor site probably null
R8072:Hspa4l UTSW 3 40,741,178 (GRCm39) missense probably damaging 0.98
R9103:Hspa4l UTSW 3 40,715,349 (GRCm39) critical splice donor site probably null
R9762:Hspa4l UTSW 3 40,727,057 (GRCm39) missense probably benign 0.01
Z1088:Hspa4l UTSW 3 40,721,425 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACAGCAATAGGTTTGTTTGGC -3'
(R):5'- TAAGAGTTCGCTTCAGAAGGC -3'

Sequencing Primer
(F):5'- CAGCAATAGGTTTGTTTGGCTTTGC -3'
(R):5'- GCAAACCAGATTGCCTAG -3'
Posted On 2022-01-20