Incidental Mutation 'R9146:Aff4'
ID 694655
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9146 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 53350833-53421830 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53408136 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 956 (N956S)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
AlphaFold Q9ESC8
Predicted Effect probably benign
Transcript: ENSMUST00000060945
AA Change: N956S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: N956S

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache G A 5: 137,290,815 G261D probably damaging Het
Adgrv1 T A 13: 81,413,172 T5408S probably benign Het
Aff3 T C 1: 38,320,119 N362D probably benign Het
Alg10b A G 15: 90,228,198 E415G probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
Cage1 T C 13: 38,023,029 D280G probably benign Het
Catsperg1 G C 7: 29,210,487 P72R probably benign Het
Cep290 A G 10: 100,541,803 E1565G probably benign Het
Csmd1 T A 8: 15,998,832 Y2290F probably benign Het
Cyp2c39 A T 19: 39,538,900 H230L Het
Efhb A G 17: 53,462,616 S222P probably benign Het
Emilin2 G A 17: 71,274,336 T465M probably damaging Het
Ep400 A T 5: 110,701,769 Y1431* probably null Het
Gm10912 T C 2: 104,066,708 V64A possibly damaging Het
Gpat2 T C 2: 127,431,286 S197P possibly damaging Het
Hc T C 2: 35,034,559 Y452C probably damaging Het
Hectd4 T C 5: 121,349,034 I3364T probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hmcn1 G A 1: 150,598,390 T4767M probably benign Het
Hspa4l A G 3: 40,781,669 D595G probably benign Het
Kdm1a G T 4: 136,602,428 T53K unknown Het
Kirrel T C 3: 87,095,708 D126G probably damaging Het
Kit T A 5: 75,649,645 D822E probably damaging Het
Kiz C T 2: 146,863,820 T100M probably benign Het
Kmt2a T A 9: 44,814,641 K3663* probably null Het
Krt8 T A 15: 101,998,935 I238F probably damaging Het
Ky C T 9: 102,542,206 P471S Het
Lca5l T C 16: 96,159,798 E493G probably damaging Het
Lrrc2 C T 9: 110,979,514 T273I probably damaging Het
Mcoln2 T C 3: 146,163,548 S31P probably benign Het
Mmp1a A G 9: 7,464,997 D77G probably damaging Het
Mrgprb8 T A 7: 48,389,452 C290* probably null Het
Nfe2l3 G T 6: 51,433,192 A96S probably damaging Het
Notch2 A G 3: 98,104,538 D624G probably damaging Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr666 T A 7: 104,893,245 I128F probably damaging Het
Olfr789 T C 10: 129,487,523 V171A possibly damaging Het
Pcdh10 G A 3: 45,379,916 A222T probably benign Het
Piezo1 G A 8: 122,500,263 H420Y Het
Plcb1 T A 2: 135,340,695 Y642N probably damaging Het
Ralgapa2 T A 2: 146,342,332 H1538L probably benign Het
Raph1 A G 1: 60,518,978 probably null Het
Rnf213 T C 11: 119,443,673 F3237S Het
Sctr A G 1: 120,054,280 D286G probably damaging Het
Smyd3 A G 1: 179,092,964 S202P probably damaging Het
Ssh2 G A 11: 77,437,676 G356E probably damaging Het
Stat3 A T 11: 100,893,666 S629R probably benign Het
Stc2 A G 11: 31,367,847 V58A probably damaging Het
Tcerg1l T A 7: 138,229,859 D463V probably damaging Het
Tctn1 A G 5: 122,251,682 V259A possibly damaging Het
Tmem248 A G 5: 130,232,010 T139A probably benign Het
Trip12 G T 1: 84,794,160 A89E possibly damaging Het
Vmn2r54 C T 7: 12,632,720 V96I probably benign Het
Vmn2r79 C T 7: 87,001,473 Q156* probably null Het
Zfp831 C A 2: 174,645,668 T712N possibly damaging Het
Zfy1 A T Y: 726,033 H577Q possibly damaging Het
Zscan4-ps2 T G 7: 11,517,752 S238R possibly damaging Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
R7755:Aff4 UTSW 11 53398379 missense probably damaging 0.97
R7848:Aff4 UTSW 11 53404512 missense probably benign 0.05
R7968:Aff4 UTSW 11 53409348 missense probably damaging 1.00
R8159:Aff4 UTSW 11 53411894 missense possibly damaging 0.71
R8218:Aff4 UTSW 11 53398257 missense probably damaging 0.98
R8241:Aff4 UTSW 11 53400171 missense probably benign 0.00
R8284:Aff4 UTSW 11 53404552 missense probably damaging 0.99
R8373:Aff4 UTSW 11 53400267 nonsense probably null
R8695:Aff4 UTSW 11 53368682 missense probably damaging 1.00
R8777:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8780:Aff4 UTSW 11 53380617 missense probably damaging 1.00
R8798:Aff4 UTSW 11 53400508 critical splice donor site probably benign
R8838:Aff4 UTSW 11 53406638 missense possibly damaging 0.77
R8939:Aff4 UTSW 11 53372404 missense probably benign
R9329:Aff4 UTSW 11 53397859 missense probably damaging 1.00
R9378:Aff4 UTSW 11 53372479 missense probably damaging 0.98
R9471:Aff4 UTSW 11 53380646 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CAGCAGACCATTATTTACAAGAAGC -3'
(R):5'- TGTCTGCAGCTGTAGCATCTG -3'

Sequencing Primer
(F):5'- TGGTATGTAAATATTCCTGATGTGC -3'
(R):5'- CTGGTGCCAAATAATTCTTTAGTTTC -3'
Posted On 2022-01-20