Incidental Mutation 'R9147:Scn7a'
ID 694680
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Name sodium channel, voltage-gated, type VII, alpha
Synonyms 1110034K09Rik, NaG, Nav2, Nax, Nav2.3, Scn6a
MMRRC Submission 068936-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R9147 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 66503770-66615254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66514507 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1089 (D1089G)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
AlphaFold B1AYL1
Predicted Effect possibly damaging
Transcript: ENSMUST00000042792
AA Change: D1089G

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: D1089G

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (93/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T A 3: 68,777,345 (GRCm39) I102N probably damaging Het
2610008E11Rik A T 10: 78,903,406 (GRCm39) C303* probably null Het
A430033K04Rik T A 5: 138,644,547 (GRCm39) V144D possibly damaging Het
Adamts13 T A 2: 26,883,024 (GRCm39) M858K probably benign Het
Ankrd29 T C 18: 12,408,760 (GRCm39) probably benign Het
Apc T A 18: 34,450,710 (GRCm39) S2535R probably damaging Het
C1s1 T C 6: 124,517,758 (GRCm39) D74G probably damaging Het
Cacnb2 G A 2: 14,972,773 (GRCm39) G227S possibly damaging Het
Cbs T C 17: 31,844,889 (GRCm39) D137G probably damaging Het
Ccdc136 A G 6: 29,418,070 (GRCm39) E846G probably damaging Het
Cd6 A T 19: 10,776,855 (GRCm39) S57T probably benign Het
Col11a2 T A 17: 34,273,119 (GRCm39) probably benign Het
Ctsj T C 13: 61,149,249 (GRCm39) Y264C probably damaging Het
Dennd3 T A 15: 73,429,463 (GRCm39) N915K probably damaging Het
Dst T C 1: 34,228,149 (GRCm39) L1914P probably damaging Het
E2f2 A T 4: 135,908,595 (GRCm39) probably null Het
Edc4 T C 8: 106,612,478 (GRCm39) L172P probably damaging Het
Epb41l5 A T 1: 119,570,319 (GRCm39) L23H probably damaging Het
Fbxo2 A G 4: 148,250,166 (GRCm39) E232G probably damaging Het
Fmn1 A C 2: 113,271,973 (GRCm39) N114H unknown Het
Foxj1 T G 11: 116,225,236 (GRCm39) I44L probably damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,052,866 (GRCm39) probably benign Het
Foxp2 A T 6: 15,286,711 (GRCm39) Q67L possibly damaging Het
Fuz C T 7: 44,549,710 (GRCm39) P396L probably damaging Het
Galntl5 A T 5: 25,415,353 (GRCm39) I295L possibly damaging Het
Gjd4 T A 18: 9,280,095 (GRCm39) T328S probably benign Het
Gramd1a A T 7: 30,837,606 (GRCm39) probably benign Het
Gzmb T C 14: 56,496,964 (GRCm39) Y219C possibly damaging Het
Hs3st5 A T 10: 36,708,917 (GRCm39) I151F probably damaging Het
Hspa12a T G 19: 58,793,890 (GRCm39) T324P probably damaging Het
Ighv4-1 A T 12: 113,912,000 (GRCm39) D84E possibly damaging Het
Il31ra C T 13: 112,670,276 (GRCm39) E371K probably benign Het
Imp4 G T 1: 34,482,473 (GRCm39) V71L probably benign Het
Itgax A G 7: 127,747,913 (GRCm39) T1068A possibly damaging Het
Klhl24 C T 16: 19,936,690 (GRCm39) R433C probably damaging Het
Larp4b C A 13: 9,186,819 (GRCm39) P49Q possibly damaging Het
Macc1 T C 12: 119,414,091 (GRCm39) S756P possibly damaging Het
Mael A G 1: 166,029,259 (GRCm39) V388A probably benign Het
Megf6 A G 4: 154,339,130 (GRCm39) T556A probably benign Het
Mettl6 T C 14: 31,204,855 (GRCm39) D189G probably damaging Het
Moxd2 C A 6: 40,860,978 (GRCm39) C271F probably damaging Het
Ncor1 A T 11: 62,224,672 (GRCm39) Y863N probably damaging Het
Ndst4 C T 3: 125,231,722 (GRCm39) A97V probably damaging Het
Nherf4 A G 9: 44,160,676 (GRCm39) C240R probably damaging Het
Nos1 G C 5: 118,017,402 (GRCm39) R255P probably benign Het
Nup160 A G 2: 90,533,489 (GRCm39) D646G probably damaging Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Or1j19 A G 2: 36,676,938 (GRCm39) T134A probably benign Het
Or1p1 A C 11: 74,180,169 (GRCm39) Q232H probably damaging Het
Or5c1 T C 2: 37,222,017 (GRCm39) L86P possibly damaging Het
Or7h8 T A 9: 20,124,358 (GRCm39) F238I probably damaging Het
Or8k24 A G 2: 86,216,324 (GRCm39) V146A probably benign Het
Pabpc6 C T 17: 9,886,937 (GRCm39) S538N probably benign Het
Pcdhga1 C A 18: 37,796,433 (GRCm39) A479D possibly damaging Het
Pdgfd A T 9: 6,333,328 (GRCm39) D172V probably benign Het
Pfpl A T 19: 12,405,804 (GRCm39) E18D possibly damaging Het
Pih1d2 T A 9: 50,532,321 (GRCm39) D126E possibly damaging Het
Ppp1r13b T C 12: 111,800,268 (GRCm39) H626R probably benign Het
Ppp6r3 A T 19: 3,543,974 (GRCm39) V347D probably damaging Het
Ptpra T A 2: 30,328,255 (GRCm39) M192K probably damaging Het
Ptpra G T 2: 30,328,256 (GRCm39) M192I probably benign Het
Ptprj G A 2: 90,288,562 (GRCm39) S801L probably benign Het
Rasd2 C T 8: 75,948,847 (GRCm39) R258* probably null Het
Rfx3 A T 19: 27,878,207 (GRCm39) V30E possibly damaging Het
Rgs2 A G 1: 143,877,925 (GRCm39) S124P probably damaging Het
Ros1 A G 10: 51,927,039 (GRCm39) F2215L probably benign Het
Rph3a T C 5: 121,086,880 (GRCm39) N440S possibly damaging Het
Sacs T C 14: 61,450,137 (GRCm39) V4061A possibly damaging Het
Scgb1b3 G A 7: 31,075,051 (GRCm39) V7M unknown Het
Sdk2 C T 11: 113,714,226 (GRCm39) R1582Q probably benign Het
Sdr16c5 T C 4: 3,996,200 (GRCm39) M298V probably benign Het
Sebox A G 11: 78,395,222 (GRCm39) D188G possibly damaging Het
Serpinf2 A T 11: 75,323,418 (GRCm39) F429L probably damaging Het
Six4 A C 12: 73,155,681 (GRCm39) S429A probably benign Het
Slc2a10 A T 2: 165,357,543 (GRCm39) H401L possibly damaging Het
Ssbp2 T C 13: 91,842,141 (GRCm39) S321P probably damaging Het
Syne2 A G 12: 75,937,158 (GRCm39) E252G probably damaging Het
Synj2 T C 17: 6,084,172 (GRCm39) I1178T probably damaging Het
Tafa5 T C 15: 87,428,775 (GRCm39) I28T probably benign Het
Tbc1d10a G T 11: 4,136,835 (GRCm39) R16L unknown Het
Tmem132b C A 5: 125,864,167 (GRCm39) Q758K probably damaging Het
Tnrc6a T G 7: 122,785,667 (GRCm39) probably benign Het
Tril A G 6: 53,795,137 (GRCm39) L695P probably damaging Het
Tspan3 A T 9: 56,043,960 (GRCm39) Y243* probably null Het
Ufl1 A T 4: 25,278,712 (GRCm39) probably benign Het
Utp4 A T 8: 107,621,310 (GRCm39) N29I possibly damaging Het
Vmn1r176 C T 7: 23,534,785 (GRCm39) G123S probably benign Het
Vmn1r225 T A 17: 20,722,577 (GRCm39) M6K possibly damaging Het
Vmn1r229 T C 17: 21,034,758 (GRCm39) M1T probably null Het
Vmn2r80 A T 10: 79,030,687 (GRCm39) I838F probably damaging Het
Vmn2r98 T A 17: 19,286,383 (GRCm39) W294R probably benign Het
Wnk1 A G 6: 119,925,631 (GRCm39) S1527P unknown Het
Zdhhc17 A T 10: 110,785,503 (GRCm39) S436R possibly damaging Het
Zfp12 T C 5: 143,230,389 (GRCm39) S271P probably damaging Het
Zfp330 T C 8: 83,491,063 (GRCm39) Y249C Het
Zfp444 A G 7: 6,192,678 (GRCm39) H232R probably damaging Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66,513,671 (GRCm39) splice site probably benign
IGL00432:Scn7a APN 2 66,572,326 (GRCm39) nonsense probably null
IGL00720:Scn7a APN 2 66,506,388 (GRCm39) missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00784:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00926:Scn7a APN 2 66,514,475 (GRCm39) missense probably benign 0.06
IGL00963:Scn7a APN 2 66,534,289 (GRCm39) splice site probably benign
IGL01099:Scn7a APN 2 66,514,582 (GRCm39) missense probably damaging 1.00
IGL01326:Scn7a APN 2 66,582,604 (GRCm39) missense probably benign 0.13
IGL01538:Scn7a APN 2 66,534,196 (GRCm39) missense probably benign
IGL01624:Scn7a APN 2 66,582,269 (GRCm39) missense probably benign 0.07
IGL01794:Scn7a APN 2 66,505,853 (GRCm39) missense probably benign
IGL02100:Scn7a APN 2 66,505,843 (GRCm39) makesense probably null
IGL02326:Scn7a APN 2 66,530,392 (GRCm39) missense probably benign 0.00
IGL02472:Scn7a APN 2 66,582,658 (GRCm39) missense probably damaging 1.00
IGL02528:Scn7a APN 2 66,530,519 (GRCm39) missense probably damaging 1.00
IGL02798:Scn7a APN 2 66,544,219 (GRCm39) missense probably benign 0.00
IGL03026:Scn7a APN 2 66,506,442 (GRCm39) missense probably damaging 0.99
IGL03071:Scn7a APN 2 66,530,291 (GRCm39) missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66,528,160 (GRCm39) missense probably benign 0.01
IGL03180:Scn7a APN 2 66,506,578 (GRCm39) missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66,506,304 (GRCm39) missense probably benign 0.00
alert UTSW 2 66,510,590 (GRCm39) nonsense probably null
glimmer UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
Uptick UTSW 2 66,530,393 (GRCm39) nonsense probably null
PIT4514001:Scn7a UTSW 2 66,514,523 (GRCm39) missense probably damaging 1.00
R0004:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66,544,381 (GRCm39) missense probably benign 0.04
R0230:Scn7a UTSW 2 66,556,628 (GRCm39) missense probably damaging 1.00
R0463:Scn7a UTSW 2 66,506,084 (GRCm39) missense probably benign 0.05
R0846:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66,510,639 (GRCm39) missense probably damaging 0.98
R1282:Scn7a UTSW 2 66,531,193 (GRCm39) missense probably damaging 0.98
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1501:Scn7a UTSW 2 66,530,507 (GRCm39) missense probably benign 0.37
R1672:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66,506,287 (GRCm39) missense probably damaging 0.99
R1712:Scn7a UTSW 2 66,535,447 (GRCm39) missense probably benign 0.05
R1758:Scn7a UTSW 2 66,531,231 (GRCm39) missense probably damaging 0.97
R1758:Scn7a UTSW 2 66,510,527 (GRCm39) missense probably benign 0.00
R1775:Scn7a UTSW 2 66,511,299 (GRCm39) missense probably benign 0.02
R1848:Scn7a UTSW 2 66,514,357 (GRCm39) critical splice donor site probably null
R1851:Scn7a UTSW 2 66,510,635 (GRCm39) missense probably benign
R1919:Scn7a UTSW 2 66,530,317 (GRCm39) missense probably damaging 1.00
R1932:Scn7a UTSW 2 66,506,446 (GRCm39) missense probably damaging 1.00
R1945:Scn7a UTSW 2 66,506,324 (GRCm39) missense probably damaging 1.00
R1970:Scn7a UTSW 2 66,514,633 (GRCm39) missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66,513,613 (GRCm39) missense probably damaging 0.99
R2008:Scn7a UTSW 2 66,518,091 (GRCm39) missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66,567,780 (GRCm39) missense probably damaging 1.00
R2113:Scn7a UTSW 2 66,506,312 (GRCm39) missense probably damaging 1.00
R2128:Scn7a UTSW 2 66,528,330 (GRCm39) missense probably damaging 0.99
R2163:Scn7a UTSW 2 66,506,300 (GRCm39) missense probably damaging 0.97
R2421:Scn7a UTSW 2 66,556,646 (GRCm39) splice site probably benign
R2446:Scn7a UTSW 2 66,523,002 (GRCm39) missense probably damaging 0.98
R2922:Scn7a UTSW 2 66,530,551 (GRCm39) splice site probably benign
R3015:Scn7a UTSW 2 66,530,240 (GRCm39) missense probably benign 0.08
R3034:Scn7a UTSW 2 66,513,152 (GRCm39) missense probably damaging 1.00
R3419:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3429:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3430:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3434:Scn7a UTSW 2 66,505,847 (GRCm39) missense probably benign 0.01
R3803:Scn7a UTSW 2 66,510,590 (GRCm39) nonsense probably null
R3831:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R3833:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R4017:Scn7a UTSW 2 66,572,329 (GRCm39) missense probably damaging 1.00
R4244:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4245:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4276:Scn7a UTSW 2 66,514,407 (GRCm39) missense probably damaging 0.97
R4307:Scn7a UTSW 2 66,506,099 (GRCm39) missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66,567,815 (GRCm39) missense probably damaging 1.00
R4353:Scn7a UTSW 2 66,506,780 (GRCm39) missense probably benign 0.00
R4721:Scn7a UTSW 2 66,514,529 (GRCm39) missense probably damaging 1.00
R4722:Scn7a UTSW 2 66,531,228 (GRCm39) missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66,534,104 (GRCm39) missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66,556,592 (GRCm39) missense probably damaging 1.00
R5362:Scn7a UTSW 2 66,530,342 (GRCm39) missense probably damaging 1.00
R5437:Scn7a UTSW 2 66,506,690 (GRCm39) missense probably damaging 1.00
R5729:Scn7a UTSW 2 66,572,301 (GRCm39) critical splice donor site probably null
R5777:Scn7a UTSW 2 66,522,913 (GRCm39) missense probably damaging 1.00
R5785:Scn7a UTSW 2 66,527,912 (GRCm39) missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
R5830:Scn7a UTSW 2 66,544,395 (GRCm39) nonsense probably null
R5877:Scn7a UTSW 2 66,530,217 (GRCm39) nonsense probably null
R5881:Scn7a UTSW 2 66,505,870 (GRCm39) missense probably benign 0.01
R5967:Scn7a UTSW 2 66,506,057 (GRCm39) missense probably damaging 1.00
R5988:Scn7a UTSW 2 66,556,558 (GRCm39) nonsense probably null
R6077:Scn7a UTSW 2 66,527,940 (GRCm39) missense probably damaging 1.00
R6135:Scn7a UTSW 2 66,534,244 (GRCm39) missense probably benign
R6242:Scn7a UTSW 2 66,531,110 (GRCm39) missense probably benign 0.00
R6264:Scn7a UTSW 2 66,505,870 (GRCm39) missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66,530,458 (GRCm39) missense probably damaging 0.98
R6544:Scn7a UTSW 2 66,514,444 (GRCm39) missense probably damaging 1.00
R6770:Scn7a UTSW 2 66,559,528 (GRCm39) splice site probably null
R6997:Scn7a UTSW 2 66,534,147 (GRCm39) missense probably damaging 1.00
R7014:Scn7a UTSW 2 66,572,303 (GRCm39) missense probably null 1.00
R7126:Scn7a UTSW 2 66,587,630 (GRCm39) missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66,530,537 (GRCm39) missense probably benign 0.14
R7176:Scn7a UTSW 2 66,506,632 (GRCm39) missense probably damaging 1.00
R7185:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66,587,506 (GRCm39) missense probably damaging 1.00
R7332:Scn7a UTSW 2 66,522,898 (GRCm39) nonsense probably null
R7421:Scn7a UTSW 2 66,505,876 (GRCm39) missense probably benign 0.07
R7488:Scn7a UTSW 2 66,587,574 (GRCm39) missense probably benign 0.16
R7636:Scn7a UTSW 2 66,574,172 (GRCm39) missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66,506,536 (GRCm39) missense probably damaging 1.00
R7711:Scn7a UTSW 2 66,531,221 (GRCm39) missense probably damaging 1.00
R7813:Scn7a UTSW 2 66,506,689 (GRCm39) missense probably damaging 1.00
R7833:Scn7a UTSW 2 66,506,494 (GRCm39) missense probably damaging 1.00
R7914:Scn7a UTSW 2 66,530,294 (GRCm39) missense probably damaging 0.97
R7953:Scn7a UTSW 2 66,587,670 (GRCm39) missense possibly damaging 0.90
R7970:Scn7a UTSW 2 66,506,173 (GRCm39) missense probably damaging 1.00
R8061:Scn7a UTSW 2 66,522,938 (GRCm39) missense probably damaging 1.00
R8121:Scn7a UTSW 2 66,531,203 (GRCm39) missense probably damaging 1.00
R8172:Scn7a UTSW 2 66,506,191 (GRCm39) missense possibly damaging 0.90
R8209:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8226:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8288:Scn7a UTSW 2 66,506,318 (GRCm39) missense probably damaging 1.00
R8431:Scn7a UTSW 2 66,534,164 (GRCm39) missense possibly damaging 0.62
R8678:Scn7a UTSW 2 66,574,041 (GRCm39) splice site probably benign
R8745:Scn7a UTSW 2 66,510,526 (GRCm39) missense probably benign
R8781:Scn7a UTSW 2 66,567,775 (GRCm39) missense probably benign 0.03
R8848:Scn7a UTSW 2 66,530,393 (GRCm39) nonsense probably null
R8878:Scn7a UTSW 2 66,506,199 (GRCm39) missense probably damaging 1.00
R8943:Scn7a UTSW 2 66,525,206 (GRCm39) synonymous silent
R8991:Scn7a UTSW 2 66,514,588 (GRCm39) missense possibly damaging 0.65
R9148:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9402:Scn7a UTSW 2 66,510,456 (GRCm39) missense probably damaging 1.00
R9501:Scn7a UTSW 2 66,582,579 (GRCm39) missense probably benign 0.00
R9546:Scn7a UTSW 2 66,582,603 (GRCm39) missense possibly damaging 0.93
R9715:Scn7a UTSW 2 66,519,902 (GRCm39) missense possibly damaging 0.93
X0060:Scn7a UTSW 2 66,520,026 (GRCm39) missense probably benign 0.01
X0066:Scn7a UTSW 2 66,510,536 (GRCm39) missense probably benign
Z1088:Scn7a UTSW 2 66,544,295 (GRCm39) missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66,582,613 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTGGACTCTAACTTGAACATG -3'
(R):5'- TGACTGTTGAGTTAGTTCCACTTAC -3'

Sequencing Primer
(F):5'- GGACTCTAACTTGAACATGAATGTG -3'
(R):5'- AACCTTACCCACTGTGAG -3'
Posted On 2022-01-20