Incidental Mutation 'R9147:Sdr16c5'
ID 694688
Institutional Source Beutler Lab
Gene Symbol Sdr16c5
Ensembl Gene ENSMUSG00000028236
Gene Name short chain dehydrogenase/reductase family 16C, member 5
Synonyms Rdhe2, Scdr9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R9147 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 3995936-4019663 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3996200 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 298 (M298V)
Ref Sequence ENSEMBL: ENSMUSP00000046298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040925]
AlphaFold Q7TQA3
Predicted Effect probably benign
Transcript: ENSMUST00000040925
AA Change: M298V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046298
Gene: ENSMUSG00000028236
AA Change: M298V

DomainStartEndE-ValueType
Pfam:KR 41 233 1.8e-17 PFAM
Pfam:adh_short 41 238 1.7e-48 PFAM
Pfam:adh_short_C2 47 228 1.3e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain alcohol dehydrogenase/reductase superfamily of proteins and is involved in the oxidation of retinol to retinaldehyde. The encoded protein is associated with the endoplasmic reticulum and is predicted to contain three transmembrane helices, suggesting that it is an integral membrane protein. It recognizes all-trans-retinol and all-trans-retinaldehyde as substrates and exhibits a strong preference for NAD(+)/NADH as cofactors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T A 3: 68,870,012 I102N probably damaging Het
2610008E11Rik A T 10: 79,067,572 C303* probably null Het
A430033K04Rik T A 5: 138,646,285 V144D possibly damaging Het
Adamts13 T A 2: 26,993,012 M858K probably benign Het
Apc T A 18: 34,317,657 S2535R probably damaging Het
C1s1 T C 6: 124,540,799 D74G probably damaging Het
Cacnb2 G A 2: 14,967,962 G227S possibly damaging Het
Cbs T C 17: 31,625,915 D137G probably damaging Het
Ccdc136 A G 6: 29,418,071 E846G probably damaging Het
Cd6 A T 19: 10,799,491 S57T probably benign Het
Ctsj T C 13: 61,001,435 Y264C probably damaging Het
Dennd3 T A 15: 73,557,614 N915K probably damaging Het
Dst T C 1: 34,189,068 L1914P probably damaging Het
E2f2 A T 4: 136,181,284 probably null Het
Edc4 T C 8: 105,885,846 L172P probably damaging Het
Epb41l5 A T 1: 119,642,589 L23H probably damaging Het
Fam19a5 T C 15: 87,544,574 I28T probably benign Het
Fbxo2 A G 4: 148,165,709 E232G probably damaging Het
Fmn1 A C 2: 113,441,628 N114H unknown Het
Foxj1 T G 11: 116,334,410 I44L probably damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Foxp2 A T 6: 15,286,712 Q67L possibly damaging Het
Fuz C T 7: 44,900,286 P396L probably damaging Het
Galntl5 A T 5: 25,210,355 I295L possibly damaging Het
Gjd4 T A 18: 9,280,095 T328S probably benign Het
Gzmb T C 14: 56,259,507 Y219C possibly damaging Het
Hs3st5 A T 10: 36,832,921 I151F probably damaging Het
Hspa12a T G 19: 58,805,458 T324P probably damaging Het
Ighv4-1 A T 12: 113,948,380 D84E possibly damaging Het
Il31ra C T 13: 112,533,742 E371K probably benign Het
Imp4 G T 1: 34,443,392 V71L probably benign Het
Itgax A G 7: 128,148,741 T1068A possibly damaging Het
Klhl24 C T 16: 20,117,940 R433C probably damaging Het
Larp4b C A 13: 9,136,783 P49Q possibly damaging Het
Macc1 T C 12: 119,450,356 S756P possibly damaging Het
Mael A G 1: 166,201,690 V388A probably benign Het
Megf6 A G 4: 154,254,673 T556A probably benign Het
Mettl6 T C 14: 31,482,898 D189G probably damaging Het
Moxd2 C A 6: 40,884,044 C271F probably damaging Het
Ncor1 A T 11: 62,333,846 Y863N probably damaging Het
Ndst4 C T 3: 125,438,073 A97V probably damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nup160 A G 2: 90,703,145 D646G probably damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr1058 A G 2: 86,385,980 V146A probably benign Het
Olfr348 A G 2: 36,786,926 T134A probably benign Het
Olfr368 T C 2: 37,332,005 L86P possibly damaging Het
Olfr59 A C 11: 74,289,343 Q232H probably damaging Het
Olfr871 T A 9: 20,213,062 F238I probably damaging Het
Pabpc6 C T 17: 9,668,008 S538N probably benign Het
Pcdhga1 C A 18: 37,663,380 A479D possibly damaging Het
Pdgfd A T 9: 6,333,328 D172V probably benign Het
Pdzd3 A G 9: 44,249,379 C240R probably damaging Het
Pfpl A T 19: 12,428,440 E18D possibly damaging Het
Pih1d2 T A 9: 50,621,021 D126E possibly damaging Het
Ppp1r13b T C 12: 111,833,834 H626R probably benign Het
Ppp6r3 A T 19: 3,493,974 V347D probably damaging Het
Ptpa T A 2: 30,438,243 M192K probably damaging Het
Ptpa G T 2: 30,438,244 M192I probably benign Het
Ptprj G A 2: 90,458,218 S801L probably benign Het
Rasd2 C T 8: 75,222,219 R258* probably null Het
Rfx3 A T 19: 27,900,807 V30E possibly damaging Het
Rgs2 A G 1: 144,002,187 S124P probably damaging Het
Ros1 A G 10: 52,050,943 F2215L probably benign Het
Rph3a T C 5: 120,948,817 N440S possibly damaging Het
Sacs T C 14: 61,212,688 V4061A possibly damaging Het
Scgb1b3 G A 7: 31,375,626 V7M unknown Het
Scn7a T C 2: 66,684,163 D1089G possibly damaging Het
Sdk2 C T 11: 113,823,400 R1582Q probably benign Het
Sebox A G 11: 78,504,396 D188G possibly damaging Het
Serpinf2 A T 11: 75,432,592 F429L probably damaging Het
Six4 A C 12: 73,108,907 S429A probably benign Het
Slc2a10 A T 2: 165,515,623 H401L possibly damaging Het
Ssbp2 T C 13: 91,694,022 S321P probably damaging Het
Syne2 A G 12: 75,890,384 E252G probably damaging Het
Synj2 T C 17: 6,033,897 I1178T probably damaging Het
Tbc1d10a G T 11: 4,186,835 R16L unknown Het
Tmem132b C A 5: 125,787,103 Q758K probably damaging Het
Tril A G 6: 53,818,152 L695P probably damaging Het
Tspan3 A T 9: 56,136,676 Y243* probably null Het
Utp4 A T 8: 106,894,678 N29I possibly damaging Het
Vmn1r176 C T 7: 23,835,360 G123S probably benign Het
Vmn1r225 T A 17: 20,502,315 M6K possibly damaging Het
Vmn1r229 T C 17: 20,814,496 M1T probably null Het
Vmn2r80 A T 10: 79,194,853 I838F probably damaging Het
Vmn2r98 T A 17: 19,066,121 W294R probably benign Het
Wnk1 A G 6: 119,948,670 S1527P unknown Het
Zdhhc17 A T 10: 110,949,642 S436R possibly damaging Het
Zfp12 T C 5: 143,244,634 S271P probably damaging Het
Zfp330 T C 8: 82,764,434 Y249C Het
Zfp444 A G 7: 6,189,679 H232R probably damaging Het
Other mutations in Sdr16c5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Sdr16c5 APN 4 4012320 splice site probably benign
IGL02230:Sdr16c5 APN 4 4016354 missense probably damaging 0.99
IGL03090:Sdr16c5 APN 4 4006575 splice site probably benign
PIT4802001:Sdr16c5 UTSW 4 4012423 missense probably damaging 1.00
R0377:Sdr16c5 UTSW 4 4005546 missense probably benign 0.03
R0610:Sdr16c5 UTSW 4 4016116 missense possibly damaging 0.81
R2012:Sdr16c5 UTSW 4 3996244 missense probably benign
R3735:Sdr16c5 UTSW 4 4005614 missense probably benign
R3839:Sdr16c5 UTSW 4 4006601 missense probably damaging 0.96
R3896:Sdr16c5 UTSW 4 4006609 missense probably damaging 1.00
R4824:Sdr16c5 UTSW 4 4016216 nonsense probably null
R5024:Sdr16c5 UTSW 4 4010365 missense probably damaging 1.00
R5194:Sdr16c5 UTSW 4 4006663 missense probably benign 0.16
R5395:Sdr16c5 UTSW 4 4016277 missense probably benign 0.12
R6267:Sdr16c5 UTSW 4 4016162 missense probably damaging 1.00
R6352:Sdr16c5 UTSW 4 4016421 missense probably benign 0.00
R7076:Sdr16c5 UTSW 4 4006591 missense probably damaging 0.99
R9336:Sdr16c5 UTSW 4 4016108 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGGAAGGACATTCTGATC -3'
(R):5'- CTAAACTGGTGATGTTTTGGAGAC -3'

Sequencing Primer
(F):5'- CCACAGCAGAACATACTTGTCTTTGG -3'
(R):5'- GAGGAAACCTCTCGGCCCAAG -3'
Posted On 2022-01-20