Mutagenetix > Incidental Mutation

Incidental Mutation 'R9147:Sdk2'

694729

Institutional Source

Beutler Lab

Gene Symbol

Sdk2

Ensembl Gene

ENSMUSG00000041592

Gene Name

sidekick cell adhesion molecule 2

Synonyms

5330435L01Rik, 4632412F08Rik

MMRRC Submission

068936-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R9147 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

113776374-114067046 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 113823400 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 1582 (R1582Q)

Ref Sequence

ENSEMBL: ENSMUSP00000038972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041627]

AlphaFold

Q6V4S5

Predicted Effect

probably benign
Transcript: ENSMUST00000041627
AA Change: R1582Q

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: R1582Q

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	43	102	4.67e-4	SMART
IG	123	208	6.07e-3	SMART
IG	225	309	1.4e-7	SMART
IGc2	325	391	6.21e-9	SMART
IGc2	418	486	8.57e-12	SMART
IG	506	591	2.37e-5	SMART
FN3	594	678	1.91e-7	SMART
FN3	694	780	2.42e-9	SMART
FN3	796	884	3.45e-5	SMART
FN3	899	981	2.36e-12	SMART
FN3	997	1084	1.64e-6	SMART
FN3	1101	1188	8.83e-12	SMART
FN3	1204	1289	3.62e-8	SMART
FN3	1305	1388	1.74e-10	SMART
FN3	1404	1489	8.23e-12	SMART
FN3	1506	1612	3.62e-8	SMART
FN3	1628	1713	1.15e-10	SMART
FN3	1728	1815	2.17e-11	SMART
FN3	1829	1913	5.04e-7	SMART
transmembrane domain	1935	1957	N/A	INTRINSIC
low complexity region	2138	2153	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (93/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032F04Rik	T	A	3: 68,870,012	I102N	probably damaging	Het
2610008E11Rik	A	T	10: 79,067,572	C303*	probably null	Het
A430033K04Rik	T	A	5: 138,646,285	V144D	possibly damaging	Het
Adamts13	T	A	2: 26,993,012	M858K	probably benign	Het
Ankrd29	T	C	18: 12,275,703		probably benign	Het
Apc	T	A	18: 34,317,657	S2535R	probably damaging	Het
C1s1	T	C	6: 124,540,799	D74G	probably damaging	Het
Cacnb2	G	A	2: 14,967,962	G227S	possibly damaging	Het
Cbs	T	C	17: 31,625,915	D137G	probably damaging	Het
Ccdc136	A	G	6: 29,418,071	E846G	probably damaging	Het
Cd6	A	T	19: 10,799,491	S57T	probably benign	Het
Col11a2	T	A	17: 34,054,145		probably benign	Het
Ctsj	T	C	13: 61,001,435	Y264C	probably damaging	Het
Dennd3	T	A	15: 73,557,614	N915K	probably damaging	Het
Dst	T	C	1: 34,189,068	L1914P	probably damaging	Het
E2f2	A	T	4: 136,181,284		probably null	Het
Edc4	T	C	8: 105,885,846	L172P	probably damaging	Het
Epb41l5	A	T	1: 119,642,589	L23H	probably damaging	Het
Fam19a5	T	C	15: 87,544,574	I28T	probably benign	Het
Fbxo2	A	G	4: 148,165,709	E232G	probably damaging	Het
Fmn1	A	C	2: 113,441,628	N114H	unknown	Het
Foxj1	T	G	11: 116,334,410	I44L	probably damaging	Het
Foxp1	TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	6: 99,075,905		probably benign	Het
Foxp2	A	T	6: 15,286,712	Q67L	possibly damaging	Het
Fuz	C	T	7: 44,900,286	P396L	probably damaging	Het
Galntl5	A	T	5: 25,210,355	I295L	possibly damaging	Het
Gjd4	T	A	18: 9,280,095	T328S	probably benign	Het
Gramd1a	A	T	7: 31,138,181		probably benign	Het
Gzmb	T	C	14: 56,259,507	Y219C	possibly damaging	Het
Hs3st5	A	T	10: 36,832,921	I151F	probably damaging	Het
Hspa12a	T	G	19: 58,805,458	T324P	probably damaging	Het
Ighv4-1	A	T	12: 113,948,380	D84E	possibly damaging	Het
Il31ra	C	T	13: 112,533,742	E371K	probably benign	Het
Imp4	G	T	1: 34,443,392	V71L	probably benign	Het
Itgax	A	G	7: 128,148,741	T1068A	possibly damaging	Het
Klhl24	C	T	16: 20,117,940	R433C	probably damaging	Het
Larp4b	C	A	13: 9,136,783	P49Q	possibly damaging	Het
Macc1	T	C	12: 119,450,356	S756P	possibly damaging	Het
Mael	A	G	1: 166,201,690	V388A	probably benign	Het
Megf6	A	G	4: 154,254,673	T556A	probably benign	Het
Mettl6	T	C	14: 31,482,898	D189G	probably damaging	Het
Moxd2	C	A	6: 40,884,044	C271F	probably damaging	Het
Ncor1	A	T	11: 62,333,846	Y863N	probably damaging	Het
Ndst4	C	T	3: 125,438,073	A97V	probably damaging	Het
Nos1	G	C	5: 117,879,337	R255P	probably benign	Het
Nup160	A	G	2: 90,703,145	D646G	probably damaging	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Olfr1058	A	G	2: 86,385,980	V146A	probably benign	Het
Olfr348	A	G	2: 36,786,926	T134A	probably benign	Het
Olfr368	T	C	2: 37,332,005	L86P	possibly damaging	Het
Olfr59	A	C	11: 74,289,343	Q232H	probably damaging	Het
Olfr871	T	A	9: 20,213,062	F238I	probably damaging	Het
Pabpc6	C	T	17: 9,668,008	S538N	probably benign	Het
Pcdhga1	C	A	18: 37,663,380	A479D	possibly damaging	Het
Pdgfd	A	T	9: 6,333,328	D172V	probably benign	Het
Pdzd3	A	G	9: 44,249,379	C240R	probably damaging	Het
Pfpl	A	T	19: 12,428,440	E18D	possibly damaging	Het
Pih1d2	T	A	9: 50,621,021	D126E	possibly damaging	Het
Ppp1r13b	T	C	12: 111,833,834	H626R	probably benign	Het
Ppp6r3	A	T	19: 3,493,974	V347D	probably damaging	Het
Ptpa	T	A	2: 30,438,243	M192K	probably damaging	Het
Ptpa	G	T	2: 30,438,244	M192I	probably benign	Het
Ptprj	G	A	2: 90,458,218	S801L	probably benign	Het
Rasd2	C	T	8: 75,222,219	R258*	probably null	Het
Rfx3	A	T	19: 27,900,807	V30E	possibly damaging	Het
Rgs2	A	G	1: 144,002,187	S124P	probably damaging	Het
Ros1	A	G	10: 52,050,943	F2215L	probably benign	Het
Rph3a	T	C	5: 120,948,817	N440S	possibly damaging	Het
Sacs	T	C	14: 61,212,688	V4061A	possibly damaging	Het
Scgb1b3	G	A	7: 31,375,626	V7M	unknown	Het
Scn7a	T	C	2: 66,684,163	D1089G	possibly damaging	Het
Sdr16c5	T	C	4: 3,996,200	M298V	probably benign	Het
Sebox	A	G	11: 78,504,396	D188G	possibly damaging	Het
Serpinf2	A	T	11: 75,432,592	F429L	probably damaging	Het
Six4	A	C	12: 73,108,907	S429A	probably benign	Het
Slc2a10	A	T	2: 165,515,623	H401L	possibly damaging	Het
Ssbp2	T	C	13: 91,694,022	S321P	probably damaging	Het
Syne2	A	G	12: 75,890,384	E252G	probably damaging	Het
Synj2	T	C	17: 6,033,897	I1178T	probably damaging	Het
Tbc1d10a	G	T	11: 4,186,835	R16L	unknown	Het
Tmem132b	C	A	5: 125,787,103	Q758K	probably damaging	Het
Tnrc6a	T	G	7: 123,186,444		probably benign	Het
Tril	A	G	6: 53,818,152	L695P	probably damaging	Het
Tspan3	A	T	9: 56,136,676	Y243*	probably null	Het
Ufl1	A	T	4: 25,278,712		probably benign	Het
Utp4	A	T	8: 106,894,678	N29I	possibly damaging	Het
Vmn1r176	C	T	7: 23,835,360	G123S	probably benign	Het
Vmn1r225	T	A	17: 20,502,315	M6K	possibly damaging	Het
Vmn1r229	T	C	17: 20,814,496	M1T	probably null	Het
Vmn2r80	A	T	10: 79,194,853	I838F	probably damaging	Het
Vmn2r98	T	A	17: 19,066,121	W294R	probably benign	Het
Wnk1	A	G	6: 119,948,670	S1527P	unknown	Het
Zdhhc17	A	T	10: 110,949,642	S436R	possibly damaging	Het
Zfp12	T	C	5: 143,244,634	S271P	probably damaging	Het
Zfp330	T	C	8: 82,764,434	Y249C		Het
Zfp444	A	G	7: 6,189,679	H232R	probably damaging	Het

Other mutations in Sdk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Sdk2	APN	11	113854384	missense	possibly damaging	0.86
IGL01063:Sdk2	APN	11	113830842	missense	probably damaging	1.00
IGL01291:Sdk2	APN	11	113843080	missense	probably benign
IGL01316:Sdk2	APN	11	113867965	missense	probably benign	0.09
IGL01614:Sdk2	APN	11	113793858	missense	probably damaging	1.00
IGL01998:Sdk2	APN	11	113838532	missense	probably damaging	0.98
IGL02014:Sdk2	APN	11	113838494	missense	probably damaging	1.00
IGL02095:Sdk2	APN	11	113834830	missense	probably damaging	1.00
IGL02115:Sdk2	APN	11	113834813	splice site	probably benign
IGL02543:Sdk2	APN	11	113868921	missense	possibly damaging	0.90
IGL02976:Sdk2	APN	11	113851842	missense	probably damaging	1.00
IGL03001:Sdk2	APN	11	113821626	missense	probably benign	0.00
IGL03122:Sdk2	APN	11	113842068	missense	probably damaging	1.00
IGL03183:Sdk2	APN	11	113850984	missense	probably benign	0.19
IGL03222:Sdk2	APN	11	113838431	missense	probably benign	0.01
IGL03310:Sdk2	APN	11	113793325	missense	possibly damaging	0.77
Curtailed	UTSW	11	113851800	missense	probably damaging	1.00
Trimmed	UTSW	11	113856696	nonsense	probably null
ANU05:Sdk2	UTSW	11	113843080	missense	probably benign
BB008:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
BB018:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0088:Sdk2	UTSW	11	113827086	missense	possibly damaging	0.74
R0096:Sdk2	UTSW	11	113903144	splice site	probably benign
R0386:Sdk2	UTSW	11	113893464	missense	probably damaging	0.96
R0396:Sdk2	UTSW	11	113829967	missense	probably benign	0.04
R0409:Sdk2	UTSW	11	113850891	splice site	probably benign
R0416:Sdk2	UTSW	11	113803203	missense	probably damaging	1.00
R0456:Sdk2	UTSW	11	113791466	missense	possibly damaging	0.93
R0544:Sdk2	UTSW	11	113781010	missense	probably damaging	1.00
R0691:Sdk2	UTSW	11	113794920	splice site	probably null
R0711:Sdk2	UTSW	11	113903144	splice site	probably benign
R0717:Sdk2	UTSW	11	113832326	missense	probably damaging	1.00
R0780:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R0831:Sdk2	UTSW	11	113832258	missense	probably damaging	0.96
R0853:Sdk2	UTSW	11	113821415	missense	probably benign	0.00
R0865:Sdk2	UTSW	11	113850922	missense	probably benign	0.12
R0930:Sdk2	UTSW	11	113838445	missense	probably benign	0.01
R0964:Sdk2	UTSW	11	113806417	splice site	probably benign
R1051:Sdk2	UTSW	11	113838646	synonymous	silent
R1052:Sdk2	UTSW	11	113838646	synonymous	silent
R1054:Sdk2	UTSW	11	113838646	synonymous	silent
R1055:Sdk2	UTSW	11	113838646	synonymous	silent
R1077:Sdk2	UTSW	11	113838646	synonymous	silent
R1079:Sdk2	UTSW	11	113838646	synonymous	silent
R1115:Sdk2	UTSW	11	113838646	synonymous	silent
R1186:Sdk2	UTSW	11	113838646	synonymous	silent
R1187:Sdk2	UTSW	11	113838646	synonymous	silent
R1337:Sdk2	UTSW	11	113832331	missense	possibly damaging	0.79
R1430:Sdk2	UTSW	11	113838646	synonymous	silent
R1433:Sdk2	UTSW	11	113795045	missense	probably damaging	0.99
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1497:Sdk2	UTSW	11	113893575	splice site	probably benign
R1514:Sdk2	UTSW	11	113838646	synonymous	silent
R1529:Sdk2	UTSW	11	113838646	synonymous	silent
R1596:Sdk2	UTSW	11	113838609	splice site	probably benign
R1680:Sdk2	UTSW	11	113791436	missense	possibly damaging	0.47
R1680:Sdk2	UTSW	11	113838646	synonymous	silent
R1770:Sdk2	UTSW	11	113793741	missense	probably benign	0.05
R1858:Sdk2	UTSW	11	113838646	synonymous	silent
R1866:Sdk2	UTSW	11	113838646	synonymous	silent
R1874:Sdk2	UTSW	11	113834956	missense	probably benign	0.00
R1899:Sdk2	UTSW	11	113838646	synonymous	silent
R1905:Sdk2	UTSW	11	113838646	synonymous	silent
R1907:Sdk2	UTSW	11	113838646	synonymous	silent
R1913:Sdk2	UTSW	11	113856726	missense	possibly damaging	0.77
R1964:Sdk2	UTSW	11	113781017	nonsense	probably null
R2055:Sdk2	UTSW	11	113850954	missense	probably damaging	1.00
R2059:Sdk2	UTSW	11	113854332	missense	probably damaging	1.00
R2093:Sdk2	UTSW	11	113943122	missense	probably damaging	1.00
R2256:Sdk2	UTSW	11	113830794	missense	probably benign	0.44
R3720:Sdk2	UTSW	11	113800244	missense	probably damaging	1.00
R3795:Sdk2	UTSW	11	113856696	nonsense	probably null
R4037:Sdk2	UTSW	11	113795055	missense	probably damaging	1.00
R4171:Sdk2	UTSW	11	113866989	splice site	probably null
R4717:Sdk2	UTSW	11	113854369	missense	probably damaging	0.96
R4758:Sdk2	UTSW	11	113827054	missense	possibly damaging	0.87
R4857:Sdk2	UTSW	11	113821382	nonsense	probably null
R4924:Sdk2	UTSW	11	113857758	missense	probably damaging	1.00
R5015:Sdk2	UTSW	11	113793761	missense	probably damaging	1.00
R5171:Sdk2	UTSW	11	113850982	missense	probably benign	0.01
R5239:Sdk2	UTSW	11	113868033	missense	probably damaging	1.00
R5243:Sdk2	UTSW	11	113825086	missense	possibly damaging	0.76
R5279:Sdk2	UTSW	11	113867031	missense	probably benign	0.31
R5535:Sdk2	UTSW	11	113943158	missense	possibly damaging	0.80
R5634:Sdk2	UTSW	11	113851714	missense	probably damaging	1.00
R5637:Sdk2	UTSW	11	113833179	missense	probably damaging	1.00
R5726:Sdk2	UTSW	11	113851800	missense	probably damaging	1.00
R5793:Sdk2	UTSW	11	113868952	missense	possibly damaging	0.46
R5798:Sdk2	UTSW	11	113827116	missense	probably damaging	1.00
R5834:Sdk2	UTSW	11	113854273	missense	probably damaging	1.00
R5863:Sdk2	UTSW	11	113834984	missense	probably damaging	0.98
R5869:Sdk2	UTSW	11	113851882	missense	probably damaging	0.96
R5875:Sdk2	UTSW	11	113830059	missense	probably benign	0.00
R5953:Sdk2	UTSW	11	113793744	missense	probably damaging	1.00
R5991:Sdk2	UTSW	11	113943254	missense	probably damaging	0.97
R6018:Sdk2	UTSW	11	113830063	missense	probably benign	0.00
R6116:Sdk2	UTSW	11	113854364	missense	probably damaging	0.99
R6328:Sdk2	UTSW	11	113793755	missense	probably damaging	1.00
R6348:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R6383:Sdk2	UTSW	11	113832265	missense	probably damaging	1.00
R6824:Sdk2	UTSW	11	113867934	missense	probably benign	0.43
R6835:Sdk2	UTSW	11	113830048	missense	probably damaging	0.98
R6853:Sdk2	UTSW	11	113780929	missense	probably damaging	0.99
R6912:Sdk2	UTSW	11	113903120	missense	probably benign	0.03
R7000:Sdk2	UTSW	11	113803169	missense	probably damaging	1.00
R7099:Sdk2	UTSW	11	113834905	missense	probably damaging	0.98
R7102:Sdk2	UTSW	11	113842690	nonsense	probably null
R7177:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7381:Sdk2	UTSW	11	113838489	missense	probably damaging	0.98
R7412:Sdk2	UTSW	11	113868083	splice site	probably null
R7504:Sdk2	UTSW	11	113867967	missense	possibly damaging	0.50
R7552:Sdk2	UTSW	11	113873213	missense	possibly damaging	0.63
R7604:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7647:Sdk2	UTSW	11	113793737	missense	probably damaging	1.00
R7897:Sdk2	UTSW	11	113873201	missense	possibly damaging	0.50
R7931:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R7998:Sdk2	UTSW	11	113859938	missense	probably benign	0.18
R8052:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8053:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8084:Sdk2	UTSW	11	113827089	missense	possibly damaging	0.67
R8136:Sdk2	UTSW	11	113851713	missense	probably damaging	1.00
R8151:Sdk2	UTSW	11	113872857	missense	possibly damaging	0.84
R8394:Sdk2	UTSW	11	113838716	missense	probably benign
R8715:Sdk2	UTSW	11	113780902	missense	probably damaging	1.00
R8774:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8774-TAIL:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8804:Sdk2	UTSW	11	113873152	nonsense	probably null
R9136:Sdk2	UTSW	11	113806377	missense	probably damaging	1.00
R9300:Sdk2	UTSW	11	113825030	missense	possibly damaging	0.63
R9354:Sdk2	UTSW	11	113834931	missense	probably benign	0.00
R9450:Sdk2	UTSW	11	113806279	missense	probably benign
R9462:Sdk2	UTSW	11	113869918	missense	possibly damaging	0.56
R9616:Sdk2	UTSW	11	113800235	missense	probably benign	0.05
R9678:Sdk2	UTSW	11	113794963	nonsense	probably null
RF002:Sdk2	UTSW	11	113885252	missense	probably benign	0.00
V1662:Sdk2	UTSW	11	113834908	missense	probably damaging	1.00
Z1176:Sdk2	UTSW	11	113839322	missense	probably benign	0.41
Z1176:Sdk2	UTSW	11	113851836	missense	probably damaging	0.97
Z1177:Sdk2	UTSW	11	113838659	missense	probably damaging	0.99
Z1177:Sdk2	UTSW	11	113839320	missense	probably damaging	1.00
Z1177:Sdk2	UTSW	11	113859956	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGTATGTGTTAGAGGCAGTCC -3'
(R):5'- AGGAATGGTTAACAGCCCTG -3'

Sequencing Primer
(F):5'- CTATTGACTGAGACGTGTAAGCC -3'
(R):5'- GAATGGTTAACAGCCCTGTCTGC -3'

Posted On

2022-01-20