Incidental Mutation 'R9147:Sdk2'
ID 694729
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Name sidekick cell adhesion molecule 2
Synonyms 5330435L01Rik, 4632412F08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R9147 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 113776374-114067046 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 113823400 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 1582 (R1582Q)
Ref Sequence ENSEMBL: ENSMUSP00000038972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627]
AlphaFold Q6V4S5
Predicted Effect probably benign
Transcript: ENSMUST00000041627
AA Change: R1582Q

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: R1582Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (93/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T A 3: 68,870,012 I102N probably damaging Het
2610008E11Rik A T 10: 79,067,572 C303* probably null Het
A430033K04Rik T A 5: 138,646,285 V144D possibly damaging Het
Adamts13 T A 2: 26,993,012 M858K probably benign Het
Ankrd29 T C 18: 12,275,703 probably benign Het
Apc T A 18: 34,317,657 S2535R probably damaging Het
C1s1 T C 6: 124,540,799 D74G probably damaging Het
Cacnb2 G A 2: 14,967,962 G227S possibly damaging Het
Cbs T C 17: 31,625,915 D137G probably damaging Het
Ccdc136 A G 6: 29,418,071 E846G probably damaging Het
Cd6 A T 19: 10,799,491 S57T probably benign Het
Col11a2 T A 17: 34,054,145 probably benign Het
Ctsj T C 13: 61,001,435 Y264C probably damaging Het
Dennd3 T A 15: 73,557,614 N915K probably damaging Het
Dst T C 1: 34,189,068 L1914P probably damaging Het
E2f2 A T 4: 136,181,284 probably null Het
Edc4 T C 8: 105,885,846 L172P probably damaging Het
Epb41l5 A T 1: 119,642,589 L23H probably damaging Het
Fam19a5 T C 15: 87,544,574 I28T probably benign Het
Fbxo2 A G 4: 148,165,709 E232G probably damaging Het
Fmn1 A C 2: 113,441,628 N114H unknown Het
Foxj1 T G 11: 116,334,410 I44L probably damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Foxp2 A T 6: 15,286,712 Q67L possibly damaging Het
Fuz C T 7: 44,900,286 P396L probably damaging Het
Galntl5 A T 5: 25,210,355 I295L possibly damaging Het
Gjd4 T A 18: 9,280,095 T328S probably benign Het
Gramd1a A T 7: 31,138,181 probably benign Het
Gzmb T C 14: 56,259,507 Y219C possibly damaging Het
Hs3st5 A T 10: 36,832,921 I151F probably damaging Het
Hspa12a T G 19: 58,805,458 T324P probably damaging Het
Ighv4-1 A T 12: 113,948,380 D84E possibly damaging Het
Il31ra C T 13: 112,533,742 E371K probably benign Het
Imp4 G T 1: 34,443,392 V71L probably benign Het
Itgax A G 7: 128,148,741 T1068A possibly damaging Het
Klhl24 C T 16: 20,117,940 R433C probably damaging Het
Larp4b C A 13: 9,136,783 P49Q possibly damaging Het
Macc1 T C 12: 119,450,356 S756P possibly damaging Het
Mael A G 1: 166,201,690 V388A probably benign Het
Megf6 A G 4: 154,254,673 T556A probably benign Het
Mettl6 T C 14: 31,482,898 D189G probably damaging Het
Moxd2 C A 6: 40,884,044 C271F probably damaging Het
Ncor1 A T 11: 62,333,846 Y863N probably damaging Het
Ndst4 C T 3: 125,438,073 A97V probably damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nup160 A G 2: 90,703,145 D646G probably damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr1058 A G 2: 86,385,980 V146A probably benign Het
Olfr348 A G 2: 36,786,926 T134A probably benign Het
Olfr368 T C 2: 37,332,005 L86P possibly damaging Het
Olfr59 A C 11: 74,289,343 Q232H probably damaging Het
Olfr871 T A 9: 20,213,062 F238I probably damaging Het
Pabpc6 C T 17: 9,668,008 S538N probably benign Het
Pcdhga1 C A 18: 37,663,380 A479D possibly damaging Het
Pdgfd A T 9: 6,333,328 D172V probably benign Het
Pdzd3 A G 9: 44,249,379 C240R probably damaging Het
Pfpl A T 19: 12,428,440 E18D possibly damaging Het
Pih1d2 T A 9: 50,621,021 D126E possibly damaging Het
Ppp1r13b T C 12: 111,833,834 H626R probably benign Het
Ppp6r3 A T 19: 3,493,974 V347D probably damaging Het
Ptpa T A 2: 30,438,243 M192K probably damaging Het
Ptpa G T 2: 30,438,244 M192I probably benign Het
Ptprj G A 2: 90,458,218 S801L probably benign Het
Rasd2 C T 8: 75,222,219 R258* probably null Het
Rfx3 A T 19: 27,900,807 V30E possibly damaging Het
Rgs2 A G 1: 144,002,187 S124P probably damaging Het
Ros1 A G 10: 52,050,943 F2215L probably benign Het
Rph3a T C 5: 120,948,817 N440S possibly damaging Het
Sacs T C 14: 61,212,688 V4061A possibly damaging Het
Scgb1b3 G A 7: 31,375,626 V7M unknown Het
Scn7a T C 2: 66,684,163 D1089G possibly damaging Het
Sdr16c5 T C 4: 3,996,200 M298V probably benign Het
Sebox A G 11: 78,504,396 D188G possibly damaging Het
Serpinf2 A T 11: 75,432,592 F429L probably damaging Het
Six4 A C 12: 73,108,907 S429A probably benign Het
Slc2a10 A T 2: 165,515,623 H401L possibly damaging Het
Ssbp2 T C 13: 91,694,022 S321P probably damaging Het
Syne2 A G 12: 75,890,384 E252G probably damaging Het
Synj2 T C 17: 6,033,897 I1178T probably damaging Het
Tbc1d10a G T 11: 4,186,835 R16L unknown Het
Tmem132b C A 5: 125,787,103 Q758K probably damaging Het
Tnrc6a T G 7: 123,186,444 probably benign Het
Tril A G 6: 53,818,152 L695P probably damaging Het
Tspan3 A T 9: 56,136,676 Y243* probably null Het
Ufl1 A T 4: 25,278,712 probably benign Het
Utp4 A T 8: 106,894,678 N29I possibly damaging Het
Vmn1r176 C T 7: 23,835,360 G123S probably benign Het
Vmn1r225 T A 17: 20,502,315 M6K possibly damaging Het
Vmn1r229 T C 17: 20,814,496 M1T probably null Het
Vmn2r80 A T 10: 79,194,853 I838F probably damaging Het
Vmn2r98 T A 17: 19,066,121 W294R probably benign Het
Wnk1 A G 6: 119,948,670 S1527P unknown Het
Zdhhc17 A T 10: 110,949,642 S436R possibly damaging Het
Zfp12 T C 5: 143,244,634 S271P probably damaging Het
Zfp330 T C 8: 82,764,434 Y249C Het
Zfp444 A G 7: 6,189,679 H232R probably damaging Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113854384 missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113830842 missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113843080 missense probably benign
IGL01316:Sdk2 APN 11 113867965 missense probably benign 0.09
IGL01614:Sdk2 APN 11 113793858 missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113838532 missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113838494 missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113834830 missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113834813 splice site probably benign
IGL02543:Sdk2 APN 11 113868921 missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113851842 missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113821626 missense probably benign 0.00
IGL03122:Sdk2 APN 11 113842068 missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113850984 missense probably benign 0.19
IGL03222:Sdk2 APN 11 113838431 missense probably benign 0.01
IGL03310:Sdk2 APN 11 113793325 missense possibly damaging 0.77
Curtailed UTSW 11 113851800 missense probably damaging 1.00
Trimmed UTSW 11 113856696 nonsense probably null
ANU05:Sdk2 UTSW 11 113843080 missense probably benign
BB008:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
BB018:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0088:Sdk2 UTSW 11 113827086 missense possibly damaging 0.74
R0096:Sdk2 UTSW 11 113903144 splice site probably benign
R0386:Sdk2 UTSW 11 113893464 missense probably damaging 0.96
R0396:Sdk2 UTSW 11 113829967 missense probably benign 0.04
R0409:Sdk2 UTSW 11 113850891 splice site probably benign
R0416:Sdk2 UTSW 11 113803203 missense probably damaging 1.00
R0456:Sdk2 UTSW 11 113791466 missense possibly damaging 0.93
R0544:Sdk2 UTSW 11 113781010 missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113794920 splice site probably null
R0711:Sdk2 UTSW 11 113903144 splice site probably benign
R0717:Sdk2 UTSW 11 113832326 missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R0831:Sdk2 UTSW 11 113832258 missense probably damaging 0.96
R0853:Sdk2 UTSW 11 113821415 missense probably benign 0.00
R0865:Sdk2 UTSW 11 113850922 missense probably benign 0.12
R0930:Sdk2 UTSW 11 113838445 missense probably benign 0.01
R0964:Sdk2 UTSW 11 113806417 splice site probably benign
R1051:Sdk2 UTSW 11 113838646 synonymous silent
R1052:Sdk2 UTSW 11 113838646 synonymous silent
R1054:Sdk2 UTSW 11 113838646 synonymous silent
R1055:Sdk2 UTSW 11 113838646 synonymous silent
R1077:Sdk2 UTSW 11 113838646 synonymous silent
R1079:Sdk2 UTSW 11 113838646 synonymous silent
R1115:Sdk2 UTSW 11 113838646 synonymous silent
R1186:Sdk2 UTSW 11 113838646 synonymous silent
R1187:Sdk2 UTSW 11 113838646 synonymous silent
R1337:Sdk2 UTSW 11 113832331 missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113838646 synonymous silent
R1433:Sdk2 UTSW 11 113795045 missense probably damaging 0.99
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1497:Sdk2 UTSW 11 113893575 splice site probably benign
R1514:Sdk2 UTSW 11 113838646 synonymous silent
R1529:Sdk2 UTSW 11 113838646 synonymous silent
R1596:Sdk2 UTSW 11 113838609 splice site probably benign
R1680:Sdk2 UTSW 11 113791436 missense possibly damaging 0.47
R1680:Sdk2 UTSW 11 113838646 synonymous silent
R1770:Sdk2 UTSW 11 113793741 missense probably benign 0.05
R1858:Sdk2 UTSW 11 113838646 synonymous silent
R1866:Sdk2 UTSW 11 113838646 synonymous silent
R1874:Sdk2 UTSW 11 113834956 missense probably benign 0.00
R1899:Sdk2 UTSW 11 113838646 synonymous silent
R1905:Sdk2 UTSW 11 113838646 synonymous silent
R1907:Sdk2 UTSW 11 113838646 synonymous silent
R1913:Sdk2 UTSW 11 113856726 missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113781017 nonsense probably null
R2055:Sdk2 UTSW 11 113850954 missense probably damaging 1.00
R2059:Sdk2 UTSW 11 113854332 missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113943122 missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113830794 missense probably benign 0.44
R3720:Sdk2 UTSW 11 113800244 missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113856696 nonsense probably null
R4037:Sdk2 UTSW 11 113795055 missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113866989 splice site probably null
R4717:Sdk2 UTSW 11 113854369 missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113827054 missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113821382 nonsense probably null
R4924:Sdk2 UTSW 11 113857758 missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113793761 missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113850982 missense probably benign 0.01
R5239:Sdk2 UTSW 11 113868033 missense probably damaging 1.00
R5243:Sdk2 UTSW 11 113825086 missense possibly damaging 0.76
R5279:Sdk2 UTSW 11 113867031 missense probably benign 0.31
R5535:Sdk2 UTSW 11 113943158 missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113851714 missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113833179 missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113851800 missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113868952 missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113827116 missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113854273 missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113834984 missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113851882 missense probably damaging 0.96
R5875:Sdk2 UTSW 11 113830059 missense probably benign 0.00
R5953:Sdk2 UTSW 11 113793744 missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113943254 missense probably damaging 0.97
R6018:Sdk2 UTSW 11 113830063 missense probably benign 0.00
R6116:Sdk2 UTSW 11 113854364 missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113793755 missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R6383:Sdk2 UTSW 11 113832265 missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113867934 missense probably benign 0.43
R6835:Sdk2 UTSW 11 113830048 missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113780929 missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113903120 missense probably benign 0.03
R7000:Sdk2 UTSW 11 113803169 missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113834905 missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113842690 nonsense probably null
R7177:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113838489 missense probably damaging 0.98
R7412:Sdk2 UTSW 11 113868083 splice site probably null
R7504:Sdk2 UTSW 11 113867967 missense possibly damaging 0.50
R7552:Sdk2 UTSW 11 113873213 missense possibly damaging 0.63
R7604:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7647:Sdk2 UTSW 11 113793737 missense probably damaging 1.00
R7897:Sdk2 UTSW 11 113873201 missense possibly damaging 0.50
R7931:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
R7998:Sdk2 UTSW 11 113859938 missense probably benign 0.18
R8052:Sdk2 UTSW 11 113854351 missense probably damaging 1.00
R8053:Sdk2 UTSW 11 113854351 missense probably damaging 1.00
R8084:Sdk2 UTSW 11 113827089 missense possibly damaging 0.67
R8136:Sdk2 UTSW 11 113851713 missense probably damaging 1.00
R8151:Sdk2 UTSW 11 113872857 missense possibly damaging 0.84
R8394:Sdk2 UTSW 11 113838716 missense probably benign
R8715:Sdk2 UTSW 11 113780902 missense probably damaging 1.00
R8774:Sdk2 UTSW 11 113839343 missense probably damaging 1.00
R8774-TAIL:Sdk2 UTSW 11 113839343 missense probably damaging 1.00
R8804:Sdk2 UTSW 11 113873152 nonsense probably null
R9136:Sdk2 UTSW 11 113806377 missense probably damaging 1.00
R9300:Sdk2 UTSW 11 113825030 missense possibly damaging 0.63
R9354:Sdk2 UTSW 11 113834931 missense probably benign 0.00
R9450:Sdk2 UTSW 11 113806279 missense probably benign
R9462:Sdk2 UTSW 11 113869918 missense possibly damaging 0.56
RF002:Sdk2 UTSW 11 113885252 missense probably benign 0.00
V1662:Sdk2 UTSW 11 113834908 missense probably damaging 1.00
Z1176:Sdk2 UTSW 11 113839322 missense probably benign 0.41
Z1176:Sdk2 UTSW 11 113851836 missense probably damaging 0.97
Z1177:Sdk2 UTSW 11 113838659 missense probably damaging 0.99
Z1177:Sdk2 UTSW 11 113839320 missense probably damaging 1.00
Z1177:Sdk2 UTSW 11 113859956 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTATGTGTTAGAGGCAGTCC -3'
(R):5'- AGGAATGGTTAACAGCCCTG -3'

Sequencing Primer
(F):5'- CTATTGACTGAGACGTGTAAGCC -3'
(R):5'- GAATGGTTAACAGCCCTGTCTGC -3'
Posted On 2022-01-20