Incidental Mutation 'R9147:Vmn2r98'
ID 694748
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock # R9147 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19053460-19082411 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19066121 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 294 (W294R)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect probably benign
Transcript: ENSMUST00000170424
AA Change: W294R

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: W294R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (93/96)
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T A 3: 68,870,012 I102N probably damaging Het
2610008E11Rik A T 10: 79,067,572 C303* probably null Het
A430033K04Rik T A 5: 138,646,285 V144D possibly damaging Het
Adamts13 T A 2: 26,993,012 M858K probably benign Het
Ankrd29 T C 18: 12,275,703 probably benign Het
Apc T A 18: 34,317,657 S2535R probably damaging Het
C1s1 T C 6: 124,540,799 D74G probably damaging Het
Cacnb2 G A 2: 14,967,962 G227S possibly damaging Het
Cbs T C 17: 31,625,915 D137G probably damaging Het
Ccdc136 A G 6: 29,418,071 E846G probably damaging Het
Cd6 A T 19: 10,799,491 S57T probably benign Het
Col11a2 T A 17: 34,054,145 probably benign Het
Ctsj T C 13: 61,001,435 Y264C probably damaging Het
Dennd3 T A 15: 73,557,614 N915K probably damaging Het
Dst T C 1: 34,189,068 L1914P probably damaging Het
E2f2 A T 4: 136,181,284 probably null Het
Edc4 T C 8: 105,885,846 L172P probably damaging Het
Epb41l5 A T 1: 119,642,589 L23H probably damaging Het
Fam19a5 T C 15: 87,544,574 I28T probably benign Het
Fbxo2 A G 4: 148,165,709 E232G probably damaging Het
Fmn1 A C 2: 113,441,628 N114H unknown Het
Foxj1 T G 11: 116,334,410 I44L probably damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Foxp2 A T 6: 15,286,712 Q67L possibly damaging Het
Fuz C T 7: 44,900,286 P396L probably damaging Het
Galntl5 A T 5: 25,210,355 I295L possibly damaging Het
Gjd4 T A 18: 9,280,095 T328S probably benign Het
Gramd1a A T 7: 31,138,181 probably benign Het
Gzmb T C 14: 56,259,507 Y219C possibly damaging Het
Hs3st5 A T 10: 36,832,921 I151F probably damaging Het
Hspa12a T G 19: 58,805,458 T324P probably damaging Het
Ighv4-1 A T 12: 113,948,380 D84E possibly damaging Het
Il31ra C T 13: 112,533,742 E371K probably benign Het
Imp4 G T 1: 34,443,392 V71L probably benign Het
Itgax A G 7: 128,148,741 T1068A possibly damaging Het
Klhl24 C T 16: 20,117,940 R433C probably damaging Het
Larp4b C A 13: 9,136,783 P49Q possibly damaging Het
Macc1 T C 12: 119,450,356 S756P possibly damaging Het
Mael A G 1: 166,201,690 V388A probably benign Het
Megf6 A G 4: 154,254,673 T556A probably benign Het
Mettl6 T C 14: 31,482,898 D189G probably damaging Het
Moxd2 C A 6: 40,884,044 C271F probably damaging Het
Ncor1 A T 11: 62,333,846 Y863N probably damaging Het
Ndst4 C T 3: 125,438,073 A97V probably damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nup160 A G 2: 90,703,145 D646G probably damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr1058 A G 2: 86,385,980 V146A probably benign Het
Olfr348 A G 2: 36,786,926 T134A probably benign Het
Olfr368 T C 2: 37,332,005 L86P possibly damaging Het
Olfr59 A C 11: 74,289,343 Q232H probably damaging Het
Olfr871 T A 9: 20,213,062 F238I probably damaging Het
Pabpc6 C T 17: 9,668,008 S538N probably benign Het
Pcdhga1 C A 18: 37,663,380 A479D possibly damaging Het
Pdgfd A T 9: 6,333,328 D172V probably benign Het
Pdzd3 A G 9: 44,249,379 C240R probably damaging Het
Pfpl A T 19: 12,428,440 E18D possibly damaging Het
Pih1d2 T A 9: 50,621,021 D126E possibly damaging Het
Ppp1r13b T C 12: 111,833,834 H626R probably benign Het
Ppp6r3 A T 19: 3,493,974 V347D probably damaging Het
Ptpa T A 2: 30,438,243 M192K probably damaging Het
Ptpa G T 2: 30,438,244 M192I probably benign Het
Ptprj G A 2: 90,458,218 S801L probably benign Het
Rasd2 C T 8: 75,222,219 R258* probably null Het
Rfx3 A T 19: 27,900,807 V30E possibly damaging Het
Rgs2 A G 1: 144,002,187 S124P probably damaging Het
Ros1 A G 10: 52,050,943 F2215L probably benign Het
Rph3a T C 5: 120,948,817 N440S possibly damaging Het
Sacs T C 14: 61,212,688 V4061A possibly damaging Het
Scgb1b3 G A 7: 31,375,626 V7M unknown Het
Scn7a T C 2: 66,684,163 D1089G possibly damaging Het
Sdk2 C T 11: 113,823,400 R1582Q probably benign Het
Sdr16c5 T C 4: 3,996,200 M298V probably benign Het
Sebox A G 11: 78,504,396 D188G possibly damaging Het
Serpinf2 A T 11: 75,432,592 F429L probably damaging Het
Six4 A C 12: 73,108,907 S429A probably benign Het
Slc2a10 A T 2: 165,515,623 H401L possibly damaging Het
Ssbp2 T C 13: 91,694,022 S321P probably damaging Het
Syne2 A G 12: 75,890,384 E252G probably damaging Het
Synj2 T C 17: 6,033,897 I1178T probably damaging Het
Tbc1d10a G T 11: 4,186,835 R16L unknown Het
Tmem132b C A 5: 125,787,103 Q758K probably damaging Het
Tnrc6a T G 7: 123,186,444 probably benign Het
Tril A G 6: 53,818,152 L695P probably damaging Het
Tspan3 A T 9: 56,136,676 Y243* probably null Het
Ufl1 A T 4: 25,278,712 probably benign Het
Utp4 A T 8: 106,894,678 N29I possibly damaging Het
Vmn1r176 C T 7: 23,835,360 G123S probably benign Het
Vmn1r225 T A 17: 20,502,315 M6K possibly damaging Het
Vmn1r229 T C 17: 20,814,496 M1T probably null Het
Vmn2r80 A T 10: 79,194,853 I838F probably damaging Het
Wnk1 A G 6: 119,948,670 S1527P unknown Het
Zdhhc17 A T 10: 110,949,642 S436R possibly damaging Het
Zfp12 T C 5: 143,244,634 S271P probably damaging Het
Zfp330 T C 8: 82,764,434 Y249C Het
Zfp444 A G 7: 6,189,679 H232R probably damaging Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
R7607:Vmn2r98 UTSW 17 19067308 missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19080535 missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19067198 splice site probably null
R7915:Vmn2r98 UTSW 17 19067231 missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19053650 missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19081163 missense probably damaging 0.99
R8241:Vmn2r98 UTSW 17 19080769 missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19066270 missense probably benign
R8952:Vmn2r98 UTSW 17 19065269 missense possibly damaging 0.76
R9148:Vmn2r98 UTSW 17 19066121 missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19081219 missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19066515 missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19067255 missense probably benign 0.01
R9487:Vmn2r98 UTSW 17 19081234 missense possibly damaging 0.78
R9753:Vmn2r98 UTSW 17 19065403 missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19065136 critical splice acceptor site probably null
Z1177:Vmn2r98 UTSW 17 19067423 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAGAGAAATGGCATCTGC -3'
(R):5'- GTTTCCCAACACATGACAATTAGTG -3'

Sequencing Primer
(F):5'- CTGCCTAGCTTTTGTAAAAATGACC -3'
(R):5'- CACAGCTTAGGAAGATAAACGTC -3'
Posted On 2022-01-20