Incidental Mutation 'R9147:Vmn2r98'
ID 694748
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
MMRRC Submission 068936-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R9147 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19273755-19301573 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19286383 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 294 (W294R)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect probably benign
Transcript: ENSMUST00000170424
AA Change: W294R

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: W294R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (93/96)
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T A 3: 68,777,345 (GRCm39) I102N probably damaging Het
2610008E11Rik A T 10: 78,903,406 (GRCm39) C303* probably null Het
A430033K04Rik T A 5: 138,644,547 (GRCm39) V144D possibly damaging Het
Adamts13 T A 2: 26,883,024 (GRCm39) M858K probably benign Het
Ankrd29 T C 18: 12,408,760 (GRCm39) probably benign Het
Apc T A 18: 34,450,710 (GRCm39) S2535R probably damaging Het
C1s1 T C 6: 124,517,758 (GRCm39) D74G probably damaging Het
Cacnb2 G A 2: 14,972,773 (GRCm39) G227S possibly damaging Het
Cbs T C 17: 31,844,889 (GRCm39) D137G probably damaging Het
Ccdc136 A G 6: 29,418,070 (GRCm39) E846G probably damaging Het
Cd6 A T 19: 10,776,855 (GRCm39) S57T probably benign Het
Col11a2 T A 17: 34,273,119 (GRCm39) probably benign Het
Ctsj T C 13: 61,149,249 (GRCm39) Y264C probably damaging Het
Dennd3 T A 15: 73,429,463 (GRCm39) N915K probably damaging Het
Dst T C 1: 34,228,149 (GRCm39) L1914P probably damaging Het
E2f2 A T 4: 135,908,595 (GRCm39) probably null Het
Edc4 T C 8: 106,612,478 (GRCm39) L172P probably damaging Het
Epb41l5 A T 1: 119,570,319 (GRCm39) L23H probably damaging Het
Fbxo2 A G 4: 148,250,166 (GRCm39) E232G probably damaging Het
Fmn1 A C 2: 113,271,973 (GRCm39) N114H unknown Het
Foxj1 T G 11: 116,225,236 (GRCm39) I44L probably damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,052,866 (GRCm39) probably benign Het
Foxp2 A T 6: 15,286,711 (GRCm39) Q67L possibly damaging Het
Fuz C T 7: 44,549,710 (GRCm39) P396L probably damaging Het
Galntl5 A T 5: 25,415,353 (GRCm39) I295L possibly damaging Het
Gjd4 T A 18: 9,280,095 (GRCm39) T328S probably benign Het
Gramd1a A T 7: 30,837,606 (GRCm39) probably benign Het
Gzmb T C 14: 56,496,964 (GRCm39) Y219C possibly damaging Het
Hs3st5 A T 10: 36,708,917 (GRCm39) I151F probably damaging Het
Hspa12a T G 19: 58,793,890 (GRCm39) T324P probably damaging Het
Ighv4-1 A T 12: 113,912,000 (GRCm39) D84E possibly damaging Het
Il31ra C T 13: 112,670,276 (GRCm39) E371K probably benign Het
Imp4 G T 1: 34,482,473 (GRCm39) V71L probably benign Het
Itgax A G 7: 127,747,913 (GRCm39) T1068A possibly damaging Het
Klhl24 C T 16: 19,936,690 (GRCm39) R433C probably damaging Het
Larp4b C A 13: 9,186,819 (GRCm39) P49Q possibly damaging Het
Macc1 T C 12: 119,414,091 (GRCm39) S756P possibly damaging Het
Mael A G 1: 166,029,259 (GRCm39) V388A probably benign Het
Megf6 A G 4: 154,339,130 (GRCm39) T556A probably benign Het
Mettl6 T C 14: 31,204,855 (GRCm39) D189G probably damaging Het
Moxd2 C A 6: 40,860,978 (GRCm39) C271F probably damaging Het
Ncor1 A T 11: 62,224,672 (GRCm39) Y863N probably damaging Het
Ndst4 C T 3: 125,231,722 (GRCm39) A97V probably damaging Het
Nherf4 A G 9: 44,160,676 (GRCm39) C240R probably damaging Het
Nos1 G C 5: 118,017,402 (GRCm39) R255P probably benign Het
Nup160 A G 2: 90,533,489 (GRCm39) D646G probably damaging Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Or1j19 A G 2: 36,676,938 (GRCm39) T134A probably benign Het
Or1p1 A C 11: 74,180,169 (GRCm39) Q232H probably damaging Het
Or5c1 T C 2: 37,222,017 (GRCm39) L86P possibly damaging Het
Or7h8 T A 9: 20,124,358 (GRCm39) F238I probably damaging Het
Or8k24 A G 2: 86,216,324 (GRCm39) V146A probably benign Het
Pabpc6 C T 17: 9,886,937 (GRCm39) S538N probably benign Het
Pcdhga1 C A 18: 37,796,433 (GRCm39) A479D possibly damaging Het
Pdgfd A T 9: 6,333,328 (GRCm39) D172V probably benign Het
Pfpl A T 19: 12,405,804 (GRCm39) E18D possibly damaging Het
Pih1d2 T A 9: 50,532,321 (GRCm39) D126E possibly damaging Het
Ppp1r13b T C 12: 111,800,268 (GRCm39) H626R probably benign Het
Ppp6r3 A T 19: 3,543,974 (GRCm39) V347D probably damaging Het
Ptpra T A 2: 30,328,255 (GRCm39) M192K probably damaging Het
Ptpra G T 2: 30,328,256 (GRCm39) M192I probably benign Het
Ptprj G A 2: 90,288,562 (GRCm39) S801L probably benign Het
Rasd2 C T 8: 75,948,847 (GRCm39) R258* probably null Het
Rfx3 A T 19: 27,878,207 (GRCm39) V30E possibly damaging Het
Rgs2 A G 1: 143,877,925 (GRCm39) S124P probably damaging Het
Ros1 A G 10: 51,927,039 (GRCm39) F2215L probably benign Het
Rph3a T C 5: 121,086,880 (GRCm39) N440S possibly damaging Het
Sacs T C 14: 61,450,137 (GRCm39) V4061A possibly damaging Het
Scgb1b3 G A 7: 31,075,051 (GRCm39) V7M unknown Het
Scn7a T C 2: 66,514,507 (GRCm39) D1089G possibly damaging Het
Sdk2 C T 11: 113,714,226 (GRCm39) R1582Q probably benign Het
Sdr16c5 T C 4: 3,996,200 (GRCm39) M298V probably benign Het
Sebox A G 11: 78,395,222 (GRCm39) D188G possibly damaging Het
Serpinf2 A T 11: 75,323,418 (GRCm39) F429L probably damaging Het
Six4 A C 12: 73,155,681 (GRCm39) S429A probably benign Het
Slc2a10 A T 2: 165,357,543 (GRCm39) H401L possibly damaging Het
Ssbp2 T C 13: 91,842,141 (GRCm39) S321P probably damaging Het
Syne2 A G 12: 75,937,158 (GRCm39) E252G probably damaging Het
Synj2 T C 17: 6,084,172 (GRCm39) I1178T probably damaging Het
Tafa5 T C 15: 87,428,775 (GRCm39) I28T probably benign Het
Tbc1d10a G T 11: 4,136,835 (GRCm39) R16L unknown Het
Tmem132b C A 5: 125,864,167 (GRCm39) Q758K probably damaging Het
Tnrc6a T G 7: 122,785,667 (GRCm39) probably benign Het
Tril A G 6: 53,795,137 (GRCm39) L695P probably damaging Het
Tspan3 A T 9: 56,043,960 (GRCm39) Y243* probably null Het
Ufl1 A T 4: 25,278,712 (GRCm39) probably benign Het
Utp4 A T 8: 107,621,310 (GRCm39) N29I possibly damaging Het
Vmn1r176 C T 7: 23,534,785 (GRCm39) G123S probably benign Het
Vmn1r225 T A 17: 20,722,577 (GRCm39) M6K possibly damaging Het
Vmn1r229 T C 17: 21,034,758 (GRCm39) M1T probably null Het
Vmn2r80 A T 10: 79,030,687 (GRCm39) I838F probably damaging Het
Wnk1 A G 6: 119,925,631 (GRCm39) S1527P unknown Het
Zdhhc17 A T 10: 110,785,503 (GRCm39) S436R possibly damaging Het
Zfp12 T C 5: 143,230,389 (GRCm39) S271P probably damaging Het
Zfp330 T C 8: 83,491,063 (GRCm39) Y249C Het
Zfp444 A G 7: 6,192,678 (GRCm39) H232R probably damaging Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19,286,007 (GRCm39) splice site probably benign
IGL01296:Vmn2r98 APN 17 19,285,447 (GRCm39) missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19,286,020 (GRCm39) missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19,285,521 (GRCm39) missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19,286,713 (GRCm39) missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19,286,548 (GRCm39) missense probably benign
IGL02123:Vmn2r98 APN 17 19,300,941 (GRCm39) missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19,286,113 (GRCm39) missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19,286,083 (GRCm39) missense probably benign
IGL02650:Vmn2r98 APN 17 19,301,223 (GRCm39) missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19,285,521 (GRCm39) missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19,286,275 (GRCm39) missense probably benign
IGL02807:Vmn2r98 APN 17 19,301,283 (GRCm39) missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19,286,242 (GRCm39) missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19,290,107 (GRCm39) missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19,301,223 (GRCm39) missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19,286,662 (GRCm39) missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19,286,089 (GRCm39) nonsense probably null
R0545:Vmn2r98 UTSW 17 19,273,875 (GRCm39) missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19,300,759 (GRCm39) missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19,300,782 (GRCm39) missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19,301,011 (GRCm39) missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19,286,210 (GRCm39) missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19,285,440 (GRCm39) missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19,301,170 (GRCm39) missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19,286,702 (GRCm39) missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19,286,680 (GRCm39) missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19,285,595 (GRCm39) nonsense probably null
R2165:Vmn2r98 UTSW 17 19,301,553 (GRCm39) missense unknown
R2238:Vmn2r98 UTSW 17 19,286,213 (GRCm39) missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19,300,698 (GRCm39) missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19,286,081 (GRCm39) missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19,301,439 (GRCm39) missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19,287,664 (GRCm39) missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19,300,887 (GRCm39) missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19,286,354 (GRCm39) missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19,290,007 (GRCm39) missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19,286,602 (GRCm39) missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19,286,419 (GRCm39) missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19,286,306 (GRCm39) missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19,273,815 (GRCm39) missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19,300,981 (GRCm39) missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19,290,016 (GRCm39) nonsense probably null
R5371:Vmn2r98 UTSW 17 19,290,015 (GRCm39) missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19,301,161 (GRCm39) missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19,286,260 (GRCm39) missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19,286,336 (GRCm39) missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19,286,143 (GRCm39) missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19,286,063 (GRCm39) missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19,285,510 (GRCm39) missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19,286,530 (GRCm39) missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19,301,184 (GRCm39) missense probably benign
R7068:Vmn2r98 UTSW 17 19,285,575 (GRCm39) missense probably benign
R7607:Vmn2r98 UTSW 17 19,287,570 (GRCm39) missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19,300,797 (GRCm39) missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19,287,460 (GRCm39) splice site probably null
R7915:Vmn2r98 UTSW 17 19,287,493 (GRCm39) missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19,273,912 (GRCm39) missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19,301,425 (GRCm39) missense probably damaging 0.99
R8241:Vmn2r98 UTSW 17 19,301,031 (GRCm39) missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19,286,532 (GRCm39) missense probably benign
R8952:Vmn2r98 UTSW 17 19,285,531 (GRCm39) missense possibly damaging 0.76
R9148:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19,301,481 (GRCm39) missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19,286,777 (GRCm39) missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19,287,517 (GRCm39) missense probably benign 0.01
R9487:Vmn2r98 UTSW 17 19,301,496 (GRCm39) missense possibly damaging 0.78
R9753:Vmn2r98 UTSW 17 19,285,665 (GRCm39) missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19,287,685 (GRCm39) nonsense probably null
Z1177:Vmn2r98 UTSW 17 19,285,398 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGGAGAGAAATGGCATCTGC -3'
(R):5'- GTTTCCCAACACATGACAATTAGTG -3'

Sequencing Primer
(F):5'- CTGCCTAGCTTTTGTAAAAATGACC -3'
(R):5'- CACAGCTTAGGAAGATAAACGTC -3'
Posted On 2022-01-20