Incidental Mutation 'R9148:Mast3'
ID 694806
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 068937-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9148 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71233091 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1074 (S1074P)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
AlphaFold Q3U214
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: S1090P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: S1090P

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: S1074P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (94/98)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T A 3: 68,777,345 (GRCm39) I102N probably damaging Het
2610008E11Rik A T 10: 78,903,406 (GRCm39) C303* probably null Het
A430033K04Rik T A 5: 138,644,547 (GRCm39) V144D possibly damaging Het
Adamts13 T A 2: 26,883,024 (GRCm39) M858K probably benign Het
Ankrd29 T C 18: 12,408,760 (GRCm39) probably benign Het
Arg1 A C 10: 24,796,655 (GRCm39) D57E probably benign Het
Bend4 G A 5: 67,557,415 (GRCm39) T467M probably damaging Het
C1s1 T C 6: 124,517,758 (GRCm39) D74G probably damaging Het
Cacnb2 G A 2: 14,972,773 (GRCm39) G227S possibly damaging Het
Cbs T C 17: 31,844,889 (GRCm39) D137G probably damaging Het
Ccdc136 A G 6: 29,418,070 (GRCm39) E846G probably damaging Het
Cd6 A T 19: 10,776,855 (GRCm39) S57T probably benign Het
Cep20 G A 16: 14,135,222 (GRCm39) probably benign Het
Col11a2 T A 17: 34,273,119 (GRCm39) probably benign Het
Col7a1 T C 9: 108,789,274 (GRCm39) S829P unknown Het
Ctsj T C 13: 61,149,249 (GRCm39) Y264C probably damaging Het
Dennd3 T A 15: 73,429,463 (GRCm39) N915K probably damaging Het
E2f2 A T 4: 135,908,595 (GRCm39) probably null Het
Eme1 T C 11: 94,538,855 (GRCm39) T342A possibly damaging Het
Epc1 A T 18: 6,453,266 (GRCm39) probably benign Het
Fat1 T C 8: 45,405,682 (GRCm39) V811A possibly damaging Het
Fbxo2 A G 4: 148,250,166 (GRCm39) E232G probably damaging Het
Flnb G T 14: 7,817,996 (GRCm38) probably benign Het
Fmn1 A C 2: 113,271,973 (GRCm39) N114H unknown Het
Foxp2 A T 6: 15,286,711 (GRCm39) Q67L possibly damaging Het
Galntl5 A T 5: 25,415,353 (GRCm39) I295L possibly damaging Het
Gjd4 T A 18: 9,280,095 (GRCm39) T328S probably benign Het
Hint2 A G 4: 43,654,952 (GRCm39) I59T probably damaging Het
Hpn C T 7: 30,802,043 (GRCm39) R252Q probably benign Het
Hspa12a T G 19: 58,793,890 (GRCm39) T324P probably damaging Het
Ighv4-1 A T 12: 113,912,000 (GRCm39) D84E possibly damaging Het
Il1r2 T A 1: 40,151,258 (GRCm39) I171N probably damaging Het
Il31ra C T 13: 112,670,276 (GRCm39) E371K probably benign Het
Klhl24 C T 16: 19,936,690 (GRCm39) R433C probably damaging Het
Klra5 C T 6: 129,886,911 (GRCm39) C39Y probably benign Het
Lypd8l T A 11: 58,499,338 (GRCm39) D160V probably benign Het
Macc1 T C 12: 119,414,091 (GRCm39) S756P possibly damaging Het
Mael A G 1: 166,029,259 (GRCm39) V388A probably benign Het
Med13 A G 11: 86,192,297 (GRCm39) C823R probably benign Het
Megf6 A G 4: 154,339,130 (GRCm39) T556A probably benign Het
Mlip A G 9: 77,045,694 (GRCm39) F14L possibly damaging Het
Moxd2 C A 6: 40,860,978 (GRCm39) C271F probably damaging Het
Myo1e A T 9: 70,283,830 (GRCm39) D842V probably damaging Het
Ndst4 C T 3: 125,231,722 (GRCm39) A97V probably damaging Het
Nherf4 A G 9: 44,160,676 (GRCm39) C240R probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nos1 G C 5: 118,017,402 (GRCm39) R255P probably benign Het
Nptx2 A G 5: 144,492,980 (GRCm39) T356A probably benign Het
Nup160 A G 2: 90,533,489 (GRCm39) D646G probably damaging Het
Nup98 C A 7: 101,788,037 (GRCm39) R1011L probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Or1j19 A G 2: 36,676,938 (GRCm39) T134A probably benign Het
Or1p1 A C 11: 74,180,169 (GRCm39) Q232H probably damaging Het
Or5c1 T C 2: 37,222,017 (GRCm39) L86P possibly damaging Het
Or7h8 T A 9: 20,124,358 (GRCm39) F238I probably damaging Het
Or8k24 A G 2: 86,216,324 (GRCm39) V146A probably benign Het
Osbp2 A G 11: 3,665,143 (GRCm39) L67P probably damaging Het
Pabpc6 C T 17: 9,886,937 (GRCm39) S538N probably benign Het
Pcdhga1 C A 18: 37,796,433 (GRCm39) A479D possibly damaging Het
Pdgfd A T 9: 6,333,328 (GRCm39) D172V probably benign Het
Pfpl A T 19: 12,405,804 (GRCm39) E18D possibly damaging Het
Plat A G 8: 23,268,466 (GRCm39) T373A probably damaging Het
Plekhg1 G A 10: 3,907,527 (GRCm39) D870N Het
Ppp1r13b T C 12: 111,800,268 (GRCm39) H626R probably benign Het
Ppp6r3 A T 19: 3,543,974 (GRCm39) V347D probably damaging Het
Prr12 G T 7: 44,697,242 (GRCm39) P891H unknown Het
Psg22 T A 7: 18,460,682 (GRCm39) I437K probably benign Het
Ptpra T A 2: 30,328,255 (GRCm39) M192K probably damaging Het
Ptpra G T 2: 30,328,256 (GRCm39) M192I probably benign Het
Ptprj G A 2: 90,288,562 (GRCm39) S801L probably benign Het
Relb T C 7: 19,350,276 (GRCm39) Y228C probably damaging Het
Rfx3 A T 19: 27,878,207 (GRCm39) V30E possibly damaging Het
Rgs2 A G 1: 143,877,925 (GRCm39) S124P probably damaging Het
Rph3a T C 5: 121,086,880 (GRCm39) N440S possibly damaging Het
Ryr2 T C 13: 11,900,424 (GRCm39) T104A probably benign Het
Scn7a T C 2: 66,514,507 (GRCm39) D1089G possibly damaging Het
Sebox A G 11: 78,395,222 (GRCm39) D188G possibly damaging Het
Serpinf2 A T 11: 75,323,418 (GRCm39) F429L probably damaging Het
Six4 A C 12: 73,155,681 (GRCm39) S429A probably benign Het
Slc2a10 A T 2: 165,357,543 (GRCm39) H401L possibly damaging Het
Spag16 G C 1: 70,420,459 (GRCm39) L482F probably damaging Het
Ssbp2 T C 13: 91,842,141 (GRCm39) S321P probably damaging Het
Syne2 A G 12: 75,937,158 (GRCm39) E252G probably damaging Het
Synj2 T C 17: 6,084,172 (GRCm39) I1178T probably damaging Het
Tafa5 T C 15: 87,428,775 (GRCm39) I28T probably benign Het
Tmem132b C A 5: 125,864,167 (GRCm39) Q758K probably damaging Het
Tril A G 6: 53,795,137 (GRCm39) L695P probably damaging Het
Ubap1l T C 9: 65,276,603 (GRCm39) L35P probably damaging Het
Vmn1r225 T A 17: 20,722,577 (GRCm39) M6K possibly damaging Het
Vmn1r229 T C 17: 21,034,758 (GRCm39) M1T probably null Het
Vmn2r80 A T 10: 79,030,687 (GRCm39) I838F probably damaging Het
Vmn2r98 T A 17: 19,286,383 (GRCm39) W294R probably benign Het
Wnk1 A G 6: 119,925,631 (GRCm39) S1527P unknown Het
Wnt11 G A 7: 98,488,241 (GRCm39) probably benign Het
Zdhhc17 A T 10: 110,785,503 (GRCm39) S436R possibly damaging Het
Zfp12 T C 5: 143,230,389 (GRCm39) S271P probably damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GAGTTTCATAAAGCCAGGCTGAGAG -3'
(R):5'- AGGTGACTGGTGTTCCTTCC -3'

Sequencing Primer
(F):5'- GAGAGCCCGCCCACCTG -3'
(R):5'- ACTGGTGTTCCTTCCGCAGAG -3'
Posted On 2022-01-20