Incidental Mutation 'R9148:Mast3'
ID 694806
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9148 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 70778117-70805054 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70780447 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1074 (S1074P)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
AlphaFold Q3U214
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: S1090P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: S1090P

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: S1074P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T A 3: 68,870,012 I102N probably damaging Het
2210407C18Rik T A 11: 58,608,512 D160V probably benign Het
2610008E11Rik A T 10: 79,067,572 C303* probably null Het
A430033K04Rik T A 5: 138,646,285 V144D possibly damaging Het
Adamts13 T A 2: 26,993,012 M858K probably benign Het
Arg1 A C 10: 24,920,757 D57E probably benign Het
Bend4 G A 5: 67,400,072 T467M probably damaging Het
C1s1 T C 6: 124,540,799 D74G probably damaging Het
Cacnb2 G A 2: 14,967,962 G227S possibly damaging Het
Cbs T C 17: 31,625,915 D137G probably damaging Het
Ccdc136 A G 6: 29,418,071 E846G probably damaging Het
Cd6 A T 19: 10,799,491 S57T probably benign Het
Col7a1 T C 9: 108,960,206 S829P unknown Het
Ctsj T C 13: 61,001,435 Y264C probably damaging Het
Dennd3 T A 15: 73,557,614 N915K probably damaging Het
E2f2 A T 4: 136,181,284 probably null Het
Eme1 T C 11: 94,648,029 T342A possibly damaging Het
Fam19a5 T C 15: 87,544,574 I28T probably benign Het
Fat1 T C 8: 44,952,645 V811A possibly damaging Het
Fbxo2 A G 4: 148,165,709 E232G probably damaging Het
Flnb G T 14: 7,817,996 probably benign Het
Fmn1 A C 2: 113,441,628 N114H unknown Het
Fopnl G A 16: 14,317,358 probably benign Het
Foxp2 A T 6: 15,286,712 Q67L possibly damaging Het
Galntl5 A T 5: 25,210,355 I295L possibly damaging Het
Gjd4 T A 18: 9,280,095 T328S probably benign Het
Hint2 A G 4: 43,654,952 I59T probably damaging Het
Hpn C T 7: 31,102,618 R252Q probably benign Het
Hspa12a T G 19: 58,805,458 T324P probably damaging Het
Ighv4-1 A T 12: 113,948,380 D84E possibly damaging Het
Il1r2 T A 1: 40,112,098 I171N probably damaging Het
Il31ra C T 13: 112,533,742 E371K probably benign Het
Klhl24 C T 16: 20,117,940 R433C probably damaging Het
Klra5 C T 6: 129,909,948 C39Y probably benign Het
Macc1 T C 12: 119,450,356 S756P possibly damaging Het
Mael A G 1: 166,201,690 V388A probably benign Het
Med13 A G 11: 86,301,471 C823R probably benign Het
Megf6 A G 4: 154,254,673 T556A probably benign Het
Mlip A G 9: 77,138,412 F14L possibly damaging Het
Moxd2 C A 6: 40,884,044 C271F probably damaging Het
Myo1e A T 9: 70,376,548 D842V probably damaging Het
Ndst4 C T 3: 125,438,073 A97V probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nptx2 A G 5: 144,556,170 T356A probably benign Het
Nup160 A G 2: 90,703,145 D646G probably damaging Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr1058 A G 2: 86,385,980 V146A probably benign Het
Olfr348 A G 2: 36,786,926 T134A probably benign Het
Olfr368 T C 2: 37,332,005 L86P possibly damaging Het
Olfr59 A C 11: 74,289,343 Q232H probably damaging Het
Olfr871 T A 9: 20,213,062 F238I probably damaging Het
Osbp2 A G 11: 3,715,143 L67P probably damaging Het
Pabpc6 C T 17: 9,668,008 S538N probably benign Het
Pcdhga1 C A 18: 37,663,380 A479D possibly damaging Het
Pdgfd A T 9: 6,333,328 D172V probably benign Het
Pdzd3 A G 9: 44,249,379 C240R probably damaging Het
Pfpl A T 19: 12,428,440 E18D possibly damaging Het
Plat A G 8: 22,778,450 T373A probably damaging Het
Plekhg1 G A 10: 3,957,527 D870N Het
Ppp1r13b T C 12: 111,833,834 H626R probably benign Het
Ppp6r3 A T 19: 3,493,974 V347D probably damaging Het
Prr12 G T 7: 45,047,818 P891H unknown Het
Psg22 T A 7: 18,726,757 I437K probably benign Het
Ptpa T A 2: 30,438,243 M192K probably damaging Het
Ptpa G T 2: 30,438,244 M192I probably benign Het
Ptprj G A 2: 90,458,218 S801L probably benign Het
Relb T C 7: 19,616,351 Y228C probably damaging Het
Rfx3 A T 19: 27,900,807 V30E possibly damaging Het
Rgs2 A G 1: 144,002,187 S124P probably damaging Het
Rph3a T C 5: 120,948,817 N440S possibly damaging Het
Ryr2 T C 13: 11,885,538 T104A probably benign Het
Scn7a T C 2: 66,684,163 D1089G possibly damaging Het
Sebox A G 11: 78,504,396 D188G possibly damaging Het
Serpinf2 A T 11: 75,432,592 F429L probably damaging Het
Six4 A C 12: 73,108,907 S429A probably benign Het
Slc2a10 A T 2: 165,515,623 H401L possibly damaging Het
Spag16 G C 1: 70,381,300 L482F probably damaging Het
Ssbp2 T C 13: 91,694,022 S321P probably damaging Het
Syne2 A G 12: 75,890,384 E252G probably damaging Het
Synj2 T C 17: 6,033,897 I1178T probably damaging Het
Tmem132b C A 5: 125,787,103 Q758K probably damaging Het
Tril A G 6: 53,818,152 L695P probably damaging Het
Ubap1l T C 9: 65,369,321 L35P probably damaging Het
Vmn1r225 T A 17: 20,502,315 M6K possibly damaging Het
Vmn1r229 T C 17: 20,814,496 M1T probably null Het
Vmn2r80 A T 10: 79,194,853 I838F probably damaging Het
Vmn2r98 T A 17: 19,066,121 W294R probably benign Het
Wnk1 A G 6: 119,948,670 S1527P unknown Het
Wnt11 G A 7: 98,839,034 probably benign Het
Zdhhc17 A T 10: 110,949,642 S436R possibly damaging Het
Zfp12 T C 5: 143,244,634 S271P probably damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 70780683 splice site probably benign
IGL01411:Mast3 APN 8 70779583 missense possibly damaging 0.50
IGL01475:Mast3 APN 8 70779530 missense probably damaging 1.00
IGL01886:Mast3 APN 8 70782139 missense possibly damaging 0.94
IGL02104:Mast3 APN 8 70787906 missense possibly damaging 0.78
IGL02236:Mast3 APN 8 70789244 missense probably benign 0.36
IGL02437:Mast3 APN 8 70780558 missense possibly damaging 0.79
IGL02704:Mast3 APN 8 70786875 missense probably damaging 1.00
IGL03155:Mast3 APN 8 70789217 missense probably damaging 1.00
IGL03366:Mast3 APN 8 70781563 nonsense probably null
gravy UTSW 8 70786635 missense probably damaging 1.00
stuffing UTSW 8 70784797 frame shift probably null
turkey UTSW 8 70785482 missense probably damaging 1.00
BB010:Mast3 UTSW 8 70786635 missense probably damaging 1.00
BB020:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R0037:Mast3 UTSW 8 70783699 critical splice donor site probably null
R0280:Mast3 UTSW 8 70783795 missense probably damaging 1.00
R0280:Mast3 UTSW 8 70787920 missense possibly damaging 0.65
R0731:Mast3 UTSW 8 70781321 missense probably damaging 1.00
R1101:Mast3 UTSW 8 70786663 missense probably damaging 1.00
R1177:Mast3 UTSW 8 70780324 missense probably damaging 1.00
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1333:Mast3 UTSW 8 70781294 missense probably damaging 1.00
R1543:Mast3 UTSW 8 70792311 missense possibly damaging 0.93
R1544:Mast3 UTSW 8 70786172 missense probably damaging 1.00
R1738:Mast3 UTSW 8 70784556 missense probably benign 0.38
R1842:Mast3 UTSW 8 70780393 missense possibly damaging 0.91
R1936:Mast3 UTSW 8 70784800 missense probably damaging 1.00
R2015:Mast3 UTSW 8 70787363 missense probably benign 0.00
R2219:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R2220:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R3711:Mast3 UTSW 8 70779607 missense probably benign 0.13
R3919:Mast3 UTSW 8 70779422 missense probably benign 0.02
R4027:Mast3 UTSW 8 70787908 missense probably damaging 1.00
R4060:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4061:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4062:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4063:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4588:Mast3 UTSW 8 70780607 nonsense probably null
R4672:Mast3 UTSW 8 70784797 frame shift probably null
R4770:Mast3 UTSW 8 70786220 missense probably damaging 1.00
R4822:Mast3 UTSW 8 70780366 missense probably damaging 1.00
R4830:Mast3 UTSW 8 70788915 missense possibly damaging 0.87
R5196:Mast3 UTSW 8 70788245 missense probably damaging 1.00
R5333:Mast3 UTSW 8 70783501 missense probably benign 0.03
R5428:Mast3 UTSW 8 70784733 missense possibly damaging 0.95
R5656:Mast3 UTSW 8 70786221 missense probably damaging 1.00
R5920:Mast3 UTSW 8 70787933 missense probably benign 0.00
R6177:Mast3 UTSW 8 70790018 missense probably damaging 1.00
R6186:Mast3 UTSW 8 70785483 missense probably damaging 1.00
R6407:Mast3 UTSW 8 70782128 missense probably benign 0.02
R6614:Mast3 UTSW 8 70781966 missense possibly damaging 0.95
R6804:Mast3 UTSW 8 70786732 missense probably benign 0.29
R6873:Mast3 UTSW 8 70786592 nonsense probably null
R6930:Mast3 UTSW 8 70799471 nonsense probably null
R6948:Mast3 UTSW 8 70785482 missense probably damaging 1.00
R7084:Mast3 UTSW 8 70779473 missense probably benign 0.14
R7253:Mast3 UTSW 8 70789682 critical splice donor site probably null
R7316:Mast3 UTSW 8 70779788 missense probably damaging 1.00
R7357:Mast3 UTSW 8 70784859 missense probably damaging 1.00
R7405:Mast3 UTSW 8 70786171 missense probably damaging 1.00
R7429:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7430:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7521:Mast3 UTSW 8 70788768 missense probably benign 0.16
R7576:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R7933:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R7998:Mast3 UTSW 8 70783570 missense probably benign
R8021:Mast3 UTSW 8 70788252 missense probably benign 0.02
R8204:Mast3 UTSW 8 70788281 missense probably benign 0.00
R8327:Mast3 UTSW 8 70779418 missense probably damaging 1.00
R8357:Mast3 UTSW 8 70780441 missense probably benign 0.39
R8415:Mast3 UTSW 8 70781222 missense probably damaging 1.00
R8457:Mast3 UTSW 8 70780441 missense probably benign 0.39
R8530:Mast3 UTSW 8 70788233 missense possibly damaging 0.92
R8891:Mast3 UTSW 8 70781157 missense probably damaging 1.00
R8930:Mast3 UTSW 8 70781733 splice site probably benign
R9002:Mast3 UTSW 8 70781260 missense probably damaging 1.00
R9085:Mast3 UTSW 8 70796717 missense unknown
R9087:Mast3 UTSW 8 70789686 missense possibly damaging 0.93
R9364:Mast3 UTSW 8 70786182 missense probably damaging 1.00
Z1177:Mast3 UTSW 8 70789038 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GAGTTTCATAAAGCCAGGCTGAGAG -3'
(R):5'- AGGTGACTGGTGTTCCTTCC -3'

Sequencing Primer
(F):5'- GAGAGCCCGCCCACCTG -3'
(R):5'- ACTGGTGTTCCTTCCGCAGAG -3'
Posted On 2022-01-20