Mutagenetix > Incidental Mutation

Incidental Mutation 'R9149:Cep152'

694866

Institutional Source

Beutler Lab

Gene Symbol

Cep152

Ensembl Gene

ENSMUSG00000068394

Gene Name

centrosomal protein 152

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9149 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

125563088-125625113 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 125621207 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 18 (E18G)

Ref Sequence

ENSEMBL: ENSMUSP00000087208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089776]

AlphaFold

A2AUM9

Predicted Effect

probably damaging
Transcript: ENSMUST00000089776
AA Change: E18G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000087208
Gene: ENSMUSG00000068394
AA Change: E18G

Domain	Start	End	E-Value	Type
low complexity region	15	29	N/A	INTRINSIC
low complexity region	106	124	N/A	INTRINSIC
coiled coil region	228	481	N/A	INTRINSIC
low complexity region	582	593	N/A	INTRINSIC
coiled coil region	602	651	N/A	INTRINSIC
coiled coil region	692	770	N/A	INTRINSIC
low complexity region	780	793	N/A	INTRINSIC
coiled coil region	835	868	N/A	INTRINSIC
coiled coil region	954	1038	N/A	INTRINSIC
coiled coil region	1205	1277	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (90/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is thought to be involved with centrosome function. Mutations in this gene have been associated with primary microcephaly (MCPH4). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
PHENOTYPE: Embryos homozygous for a null allele exhibit reduced numbers of centrosomes and cilia, increased apoptosis, and midgestation lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,446,304	S103N	probably benign	Het
Ace	A	G	11: 105,972,473	D358G	possibly damaging	Het
Acvr2b	A	T	9: 119,428,050	H115L	probably damaging	Het
Adam15	G	A	3: 89,347,435	T106I	possibly damaging	Het
Adamts16	A	G	13: 70,735,829	C1076R	probably damaging	Het
Adcy5	A	G	16: 35,272,111	Y614C	probably damaging	Het
Adhfe1	A	T	1: 9,557,051	H225L	probably benign	Het
Aff3	A	G	1: 38,181,316	I1171T	probably damaging	Het
Agps	T	A	2: 75,866,838	M334K	probably damaging	Het
Akr1e1	A	G	13: 4,602,679		probably null	Het
Als2cl	G	A	9: 110,889,123	V311M	probably benign	Het
Amdhd1	A	T	10: 93,539,951	L7H	probably damaging	Het
Apba1	A	T	19: 23,893,418	I205F	probably damaging	Het
Arhgap26	A	T	18: 39,111,864	E187D	possibly damaging	Het
Ash1l	A	T	3: 89,007,223	H1720L	probably benign	Het
Atp9a	T	C	2: 168,734,068		probably benign	Het
Bcl7c	G	A	7: 127,708,523	A2V	probably damaging	Het
Catsperg1	G	C	7: 29,210,487	P72R	probably benign	Het
Ccdc103	G	A	11: 102,884,096	G174R	probably benign	Het
Ccdc171	A	T	4: 83,694,275	K976M	probably damaging	Het
Ceacam1	T	C	7: 25,473,935	N276S	possibly damaging	Het
Cers3	T	C	7: 66,743,694	L17P	probably benign	Het
Cpsf3	A	G	12: 21,306,843	N489S	possibly damaging	Het
Cramp1l	A	G	17: 24,968,946	S1225P	probably damaging	Het
Dck	G	A	5: 88,765,307	G18R	probably benign	Het
Dnah5	A	T	15: 28,387,768	E3124D	probably benign	Het
Eogt	T	G	6: 97,113,878	L433F	probably damaging	Het
Fam135b	A	G	15: 71,462,895	S817P		Het
Fsip2	T	C	2: 82,982,030	Y2898H	possibly damaging	Het
Fzr1	T	C	10: 81,369,415	H249R	probably benign	Het
Gbp10	T	G	5: 105,218,995	Q457P	probably damaging	Het
Gin1	G	C	1: 97,783,094	L167F	probably damaging	Het
Gm14226	A	T	2: 155,024,923	I267F	probably damaging	Het
Gmnc	A	G	16: 26,962,892		probably null	Het
Hectd2	A	T	19: 36,599,002	I311F	probably damaging	Het
Heg1	A	G	16: 33,738,591	K1085E	probably benign	Het
Hmbs	G	A	9: 44,341,686	Q34*	probably null	Het
Hyal6	T	A	6: 24,734,152	M28K	probably benign	Het
Ifi27	T	C	12: 103,439,419	V141A	possibly damaging	Het
Ift122	T	A	6: 115,890,531	I414N	probably damaging	Het
Iglv2	A	T	16: 19,260,684	V23E	probably damaging	Het
Itgax	A	T	7: 128,131,469	I120L	probably benign	Het
Kifc3	A	G	8: 95,126,689	I13T	probably benign	Het
Lmod3	T	C	6: 97,247,664	N399D	probably damaging	Het
Macf1	A	T	4: 123,471,533	I3145K	probably benign	Het
Map2k5	A	C	9: 63,293,724	I209S	probably damaging	Het
Mbd5	A	G	2: 49,251,376	E117G	probably damaging	Het
Milr1	A	G	11: 106,761,279	H172R	probably benign	Het
Myod1	A	C	7: 46,377,169	D166A		Het
Neb	C	T	2: 52,210,866	V4647M	possibly damaging	Het
Nek1	A	T	8: 61,121,021	D1101V	probably damaging	Het
Nlrp2	A	T	7: 5,327,573	V608D	probably benign	Het
Noc3l	G	A	19: 38,812,391	Q216*	probably null	Het
Nos1	G	C	5: 117,879,337	R255P	probably benign	Het
Nup160	T	A	2: 90,722,241		probably benign	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Oat	C	T	7: 132,564,277	S193N	probably benign	Het
Olfr1	T	A	11: 73,396,027		probably benign	Het
Olfr1148	G	T	2: 87,833,179	G47*	probably null	Het
Olfr344	T	G	2: 36,568,976	F126C	probably benign	Het
Olfr776	A	G	10: 129,261,315	Y118C	probably damaging	Het
Olfr812	A	G	10: 129,842,613	V143A	probably damaging	Het
Oma1	A	G	4: 103,325,017		probably null	Het
Os9	A	G	10: 127,098,049	S500P	possibly damaging	Het
Osbpl11	A	T	16: 33,227,290	N541I		Het
Pcnx4	A	G	12: 72,566,897	I539V	probably benign	Het
Ppfia3	T	A	7: 45,350,293		probably null	Het
Ppp1r3a	T	C	6: 14,722,099	K275E	probably benign	Het
Pten	A	G	19: 32,792,572	N63S	probably benign	Het
Rptor	A	G	11: 119,887,070	N1020S	probably benign	Het
Sall2	C	A	14: 52,313,216	D841Y	possibly damaging	Het
Sbno1	T	A	5: 124,381,699	H1172L	probably benign	Het
Scaf4	A	T	16: 90,230,166	L921Q	probably damaging	Het
Sec22c	C	A	9: 121,695,684	R11L	probably damaging	Het
Skint6	T	A	4: 113,176,976	D318V	probably damaging	Het
Slc22a28	T	C	19: 8,071,840	N348S	probably benign	Het
Slc44a2	G	T	9: 21,342,009	K77N	possibly damaging	Het
Smc1b	C	T	15: 85,066,230	V1198I	probably benign	Het
Spef2	A	T	15: 9,717,482	M316K	probably damaging	Het
Stra8	T	C	6: 34,934,081	Y215H	probably damaging	Het
Sv2a	G	T	3: 96,189,694	R445L	probably benign	Het
Sycp1	A	C	3: 102,851,628	L771R	probably damaging	Het
Tchp	A	T	5: 114,721,123	R493*	probably null	Het
Ttc13	G	A	8: 124,683,300	A391V	probably benign	Het
Unc13b	C	T	4: 43,176,186	T2338I	unknown	Het
Wac	A	G	18: 7,921,592	D576G	probably damaging	Het
Wdr34	T	A	2: 30,033,941	T191S	probably benign	Het
Xdh	T	C	17: 73,915,693	N559S	probably benign	Het
Zscan20	A	T	4: 128,588,121	S583T	probably benign	Het

Other mutations in Cep152

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Cep152	APN	2	125563888	missense	probably benign	0.01
IGL00561:Cep152	APN	2	125563723	nonsense	probably null
IGL01082:Cep152	APN	2	125569545	splice site	probably benign
IGL01420:Cep152	APN	2	125563652	missense	possibly damaging	0.49
IGL01832:Cep152	APN	2	125618494	nonsense	probably null
IGL02106:Cep152	APN	2	125602936	splice site	probably null
IGL02124:Cep152	APN	2	125563461	missense	probably benign	0.23
IGL02349:Cep152	APN	2	125594956	missense	probably damaging	0.99
IGL02541:Cep152	APN	2	125605354	missense	probably damaging	1.00
IGL02659:Cep152	APN	2	125579549	missense	probably damaging	0.96
IGL02711:Cep152	APN	2	125563942	missense	possibly damaging	0.93
IGL02737:Cep152	APN	2	125586474	missense	possibly damaging	0.71
IGL03060:Cep152	APN	2	125619987	splice site	probably benign
IGL03095:Cep152	APN	2	125618451	missense	probably benign	0.00
IGL03186:Cep152	APN	2	125563975	missense	probably benign
IGL03306:Cep152	APN	2	125605408	missense	possibly damaging	0.90
R0034:Cep152	UTSW	2	125583893	missense	probably benign	0.00
R0034:Cep152	UTSW	2	125583893	missense	probably benign	0.00
R0079:Cep152	UTSW	2	125618453	missense	possibly damaging	0.92
R0244:Cep152	UTSW	2	125564214	missense	probably benign	0.00
R0390:Cep152	UTSW	2	125576869	splice site	probably benign
R0462:Cep152	UTSW	2	125583934	missense	possibly damaging	0.64
R0480:Cep152	UTSW	2	125581719	missense	possibly damaging	0.95
R0595:Cep152	UTSW	2	125595063	missense	probably damaging	0.99
R0973:Cep152	UTSW	2	125594899	missense	probably benign	0.00
R0973:Cep152	UTSW	2	125594899	missense	probably benign	0.00
R1634:Cep152	UTSW	2	125583889	missense	probably benign	0.00
R1664:Cep152	UTSW	2	125566254	missense	probably benign	0.38
R1693:Cep152	UTSW	2	125566254	missense	probably benign	0.38
R1887:Cep152	UTSW	2	125620305	missense	probably benign	0.00
R1930:Cep152	UTSW	2	125618371	critical splice donor site	probably null
R2178:Cep152	UTSW	2	125580034	splice site	probably null
R2225:Cep152	UTSW	2	125581784	missense	probably damaging	1.00
R2324:Cep152	UTSW	2	125563462	missense	probably benign	0.38
R2416:Cep152	UTSW	2	125564172	nonsense	probably null
R2845:Cep152	UTSW	2	125587974	missense	probably damaging	1.00
R3753:Cep152	UTSW	2	125625052	unclassified	probably benign
R4212:Cep152	UTSW	2	125620001	missense	probably benign	0.00
R4304:Cep152	UTSW	2	125563723	nonsense	probably null
R4371:Cep152	UTSW	2	125613047	missense	probably damaging	1.00
R4399:Cep152	UTSW	2	125587980	missense	possibly damaging	0.63
R4536:Cep152	UTSW	2	125602947	splice site	probably null
R4713:Cep152	UTSW	2	125587948	missense	possibly damaging	0.79
R4777:Cep152	UTSW	2	125564095	missense	probably benign	0.29
R4779:Cep152	UTSW	2	125568892	missense	possibly damaging	0.52
R4785:Cep152	UTSW	2	125586329	critical splice donor site	probably null
R4816:Cep152	UTSW	2	125563754	missense	probably damaging	1.00
R4847:Cep152	UTSW	2	125618474	missense	possibly damaging	0.62
R4898:Cep152	UTSW	2	125586381	missense	probably benign	0.03
R4934:Cep152	UTSW	2	125611096	missense	possibly damaging	0.52
R4997:Cep152	UTSW	2	125586351	missense	probably benign	0.00
R5068:Cep152	UTSW	2	125571816	missense	probably benign	0.25
R5183:Cep152	UTSW	2	125566638	missense	probably damaging	1.00
R5198:Cep152	UTSW	2	125587624	missense	probably benign
R5261:Cep152	UTSW	2	125564205	missense	probably benign	0.06
R5272:Cep152	UTSW	2	125611030	missense	probably benign	0.27
R5284:Cep152	UTSW	2	125580021	missense	probably damaging	1.00
R6029:Cep152	UTSW	2	125563632	missense	probably benign	0.44
R6155:Cep152	UTSW	2	125581700	missense	probably benign
R6239:Cep152	UTSW	2	125579412	missense	probably benign	0.40
R6590:Cep152	UTSW	2	125564370	missense	probably damaging	1.00
R6690:Cep152	UTSW	2	125564370	missense	probably damaging	1.00
R6754:Cep152	UTSW	2	125587668	missense	probably damaging	0.99
R6798:Cep152	UTSW	2	125566527	splice site	probably null
R6816:Cep152	UTSW	2	125595027	missense	probably damaging	1.00
R6977:Cep152	UTSW	2	125568822	critical splice donor site	probably null
R7125:Cep152	UTSW	2	125566673	nonsense	probably null
R7146:Cep152	UTSW	2	125614405	missense	probably benign	0.06
R7588:Cep152	UTSW	2	125569626	missense	probably damaging	1.00
R7852:Cep152	UTSW	2	125590113	missense	possibly damaging	0.82
R7883:Cep152	UTSW	2	125613058	missense	possibly damaging	0.50
R8047:Cep152	UTSW	2	125564327	missense	probably benign	0.10
R8082:Cep152	UTSW	2	125586393	missense	probably benign
R8680:Cep152	UTSW	2	125564211	nonsense	probably null
R8739:Cep152	UTSW	2	125620055	missense	probably benign	0.06
R8744:Cep152	UTSW	2	125594871	critical splice donor site	probably null
R8896:Cep152	UTSW	2	125566235	missense	possibly damaging	0.55
R8924:Cep152	UTSW	2	125602858	missense	possibly damaging	0.91
R8971:Cep152	UTSW	2	125579850	nonsense	probably null
R9004:Cep152	UTSW	2	125611100	missense	probably benign	0.29
R9149:Cep152	UTSW	2	125619883	missense	probably damaging	0.99
R9161:Cep152	UTSW	2	125566654	nonsense	probably null
R9239:Cep152	UTSW	2	125583910	missense	probably benign	0.02
R9249:Cep152	UTSW	2	125563984	missense	probably benign	0.38
R9258:Cep152	UTSW	2	125579436	nonsense	probably null
R9619:Cep152	UTSW	2	125594907	missense	probably benign	0.00
R9643:Cep152	UTSW	2	125564230	nonsense	probably null
R9775:Cep152	UTSW	2	125581740	nonsense	probably null
X0009:Cep152	UTSW	2	125614386	missense	probably damaging	1.00
X0010:Cep152	UTSW	2	125614386	missense	probably damaging	1.00
X0011:Cep152	UTSW	2	125614386	missense	probably damaging	1.00
X0014:Cep152	UTSW	2	125614386	missense	probably damaging	1.00
X0017:Cep152	UTSW	2	125614386	missense	probably damaging	1.00
X0021:Cep152	UTSW	2	125614386	missense	probably damaging	1.00
X0022:Cep152	UTSW	2	125620063	missense	probably benign	0.07
X0023:Cep152	UTSW	2	125614386	missense	probably damaging	1.00
X0028:Cep152	UTSW	2	125614386	missense	probably damaging	1.00
X0033:Cep152	UTSW	2	125614386	missense	probably damaging	1.00
X0064:Cep152	UTSW	2	125614386	missense	probably damaging	1.00
X0067:Cep152	UTSW	2	125614386	missense	probably damaging	1.00
Z1176:Cep152	UTSW	2	125583971	missense	probably benign	0.23
Z1177:Cep152	UTSW	2	125614324	missense	probably benign	0.33
Z1177:Cep152	UTSW	2	125619704	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACACAGCCATTTTGCCAGC -3'
(R):5'- AATTGAGGCTTTGCTTGAGC -3'

Sequencing Primer
(F):5'- GTTCCTCTACTGTTTAAAAGTCCAG -3'
(R):5'- TTGAAAATATCCTTTAGCCACTTGGG -3'

Posted On

2022-01-20