Mutagenetix > Incidental Mutation

Incidental Mutation 'R9149:Skint6'

694875

Institutional Source

Beutler Lab

Gene Symbol

Skint6

Ensembl Gene

ENSMUSG00000087194

Gene Name

selection and upkeep of intraepithelial T cells 6

Synonyms

OTTMUSG00000008519

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R9149 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

112804616-113286973 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 113176976 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 318 (D318V)

Ref Sequence

ENSEMBL: ENSMUSP00000121870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]

AlphaFold

A7XUZ6

Predicted Effect

probably damaging
Transcript: ENSMUST00000138966
AA Change: D318V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: D318V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000171224
AA Change: D318V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: D318V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (90/90)

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,446,304	S103N	probably benign	Het
Ace	A	G	11: 105,972,473	D358G	possibly damaging	Het
Acvr2b	A	T	9: 119,428,050	H115L	probably damaging	Het
Adam15	G	A	3: 89,347,435	T106I	possibly damaging	Het
Adamts16	A	G	13: 70,735,829	C1076R	probably damaging	Het
Adcy5	A	G	16: 35,272,111	Y614C	probably damaging	Het
Adhfe1	A	T	1: 9,557,051	H225L	probably benign	Het
Aff3	A	G	1: 38,181,316	I1171T	probably damaging	Het
Agps	T	A	2: 75,866,838	M334K	probably damaging	Het
Akr1e1	A	G	13: 4,602,679		probably null	Het
Als2cl	G	A	9: 110,889,123	V311M	probably benign	Het
Amdhd1	A	T	10: 93,539,951	L7H	probably damaging	Het
Apba1	A	T	19: 23,893,418	I205F	probably damaging	Het
Arhgap26	A	T	18: 39,111,864	E187D	possibly damaging	Het
Ash1l	A	T	3: 89,007,223	H1720L	probably benign	Het
Atp9a	T	C	2: 168,734,068		probably benign	Het
Bcl7c	G	A	7: 127,708,523	A2V	probably damaging	Het
Catsperg1	G	C	7: 29,210,487	P72R	probably benign	Het
Ccdc103	G	A	11: 102,884,096	G174R	probably benign	Het
Ccdc171	A	T	4: 83,694,275	K976M	probably damaging	Het
Ceacam1	T	C	7: 25,473,935	N276S	possibly damaging	Het
Cep152	T	C	2: 125,619,883	N91S	probably damaging	Het
Cep152	T	C	2: 125,621,207	E18G	probably damaging	Het
Cers3	T	C	7: 66,743,694	L17P	probably benign	Het
Cpsf3	A	G	12: 21,306,843	N489S	possibly damaging	Het
Cramp1l	A	G	17: 24,968,946	S1225P	probably damaging	Het
Dck	G	A	5: 88,765,307	G18R	probably benign	Het
Dnah5	A	T	15: 28,387,768	E3124D	probably benign	Het
Eogt	T	G	6: 97,113,878	L433F	probably damaging	Het
Fam135b	A	G	15: 71,462,895	S817P		Het
Fsip2	T	C	2: 82,982,030	Y2898H	possibly damaging	Het
Fzr1	T	C	10: 81,369,415	H249R	probably benign	Het
Gbp10	T	G	5: 105,218,995	Q457P	probably damaging	Het
Gin1	G	C	1: 97,783,094	L167F	probably damaging	Het
Gm14226	A	T	2: 155,024,923	I267F	probably damaging	Het
Gmnc	A	G	16: 26,962,892		probably null	Het
Hectd2	A	T	19: 36,599,002	I311F	probably damaging	Het
Heg1	A	G	16: 33,738,591	K1085E	probably benign	Het
Hmbs	G	A	9: 44,341,686	Q34*	probably null	Het
Hyal6	T	A	6: 24,734,152	M28K	probably benign	Het
Ifi27	T	C	12: 103,439,419	V141A	possibly damaging	Het
Ift122	T	A	6: 115,890,531	I414N	probably damaging	Het
Iglv2	A	T	16: 19,260,684	V23E	probably damaging	Het
Itgax	A	T	7: 128,131,469	I120L	probably benign	Het
Kifc3	A	G	8: 95,126,689	I13T	probably benign	Het
Lmod3	T	C	6: 97,247,664	N399D	probably damaging	Het
Macf1	A	T	4: 123,471,533	I3145K	probably benign	Het
Map2k5	A	C	9: 63,293,724	I209S	probably damaging	Het
Mbd5	A	G	2: 49,251,376	E117G	probably damaging	Het
Milr1	A	G	11: 106,761,279	H172R	probably benign	Het
Myod1	A	C	7: 46,377,169	D166A		Het
Neb	C	T	2: 52,210,866	V4647M	possibly damaging	Het
Nek1	A	T	8: 61,121,021	D1101V	probably damaging	Het
Nlrp2	A	T	7: 5,327,573	V608D	probably benign	Het
Noc3l	G	A	19: 38,812,391	Q216*	probably null	Het
Nos1	G	C	5: 117,879,337	R255P	probably benign	Het
Nup160	T	A	2: 90,722,241		probably benign	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Oat	C	T	7: 132,564,277	S193N	probably benign	Het
Olfr1	T	A	11: 73,396,027		probably benign	Het
Olfr1148	G	T	2: 87,833,179	G47*	probably null	Het
Olfr344	T	G	2: 36,568,976	F126C	probably benign	Het
Olfr776	A	G	10: 129,261,315	Y118C	probably damaging	Het
Olfr812	A	G	10: 129,842,613	V143A	probably damaging	Het
Oma1	A	G	4: 103,325,017		probably null	Het
Os9	A	G	10: 127,098,049	S500P	possibly damaging	Het
Osbpl11	A	T	16: 33,227,290	N541I		Het
Pcnx4	A	G	12: 72,566,897	I539V	probably benign	Het
Ppfia3	T	A	7: 45,350,293		probably null	Het
Ppp1r3a	T	C	6: 14,722,099	K275E	probably benign	Het
Pten	A	G	19: 32,792,572	N63S	probably benign	Het
Rptor	A	G	11: 119,887,070	N1020S	probably benign	Het
Sall2	C	A	14: 52,313,216	D841Y	possibly damaging	Het
Sbno1	T	A	5: 124,381,699	H1172L	probably benign	Het
Scaf4	A	T	16: 90,230,166	L921Q	probably damaging	Het
Sec22c	C	A	9: 121,695,684	R11L	probably damaging	Het
Slc22a28	T	C	19: 8,071,840	N348S	probably benign	Het
Slc44a2	G	T	9: 21,342,009	K77N	possibly damaging	Het
Smc1b	C	T	15: 85,066,230	V1198I	probably benign	Het
Spef2	A	T	15: 9,717,482	M316K	probably damaging	Het
Stra8	T	C	6: 34,934,081	Y215H	probably damaging	Het
Sv2a	G	T	3: 96,189,694	R445L	probably benign	Het
Sycp1	A	C	3: 102,851,628	L771R	probably damaging	Het
Tchp	A	T	5: 114,721,123	R493*	probably null	Het
Ttc13	G	A	8: 124,683,300	A391V	probably benign	Het
Unc13b	C	T	4: 43,176,186	T2338I	unknown	Het
Wac	A	G	18: 7,921,592	D576G	probably damaging	Het
Wdr34	T	A	2: 30,033,941	T191S	probably benign	Het
Xdh	T	C	17: 73,915,693	N559S	probably benign	Het
Zscan20	A	T	4: 128,588,121	S583T	probably benign	Het

Other mutations in Skint6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Skint6	APN	4	112804682	missense	possibly damaging	0.96
IGL01296:Skint6	APN	4	113236440	missense	probably benign	0.37
IGL01343:Skint6	APN	4	113283626	missense	probably benign	0.07
IGL01543:Skint6	APN	4	112899963	missense	probably benign	0.18
IGL01633:Skint6	APN	4	113238049	missense	probably damaging	1.00
IGL01818:Skint6	APN	4	112948569	missense	probably benign	0.18
IGL02124:Skint6	APN	4	113087796	missense	probably benign
IGL02517:Skint6	APN	4	112948540	splice site	probably benign
IGL02647:Skint6	APN	4	113127891	splice site	probably benign
IGL02887:Skint6	APN	4	113238184	nonsense	probably null
IGL03026:Skint6	APN	4	112991244	splice site	probably null
IGL03030:Skint6	APN	4	113012956	missense	probably benign	0.03
meissner	UTSW	4	112804694	missense	possibly damaging	0.86
Tegmentum	UTSW	4	112842822	splice site	probably null
PIT4576001:Skint6	UTSW	4	113053367	missense	possibly damaging	0.91
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0099:Skint6	UTSW	4	112811501	missense	possibly damaging	0.53
R0158:Skint6	UTSW	4	113184814	splice site	probably benign
R0164:Skint6	UTSW	4	112991236	splice site	probably benign
R0312:Skint6	UTSW	4	112809100	missense	possibly damaging	0.86
R0591:Skint6	UTSW	4	112858169	splice site	probably benign
R0762:Skint6	UTSW	4	112865651	splice site	probably benign
R0941:Skint6	UTSW	4	113238358	missense	probably damaging	1.00
R1023:Skint6	UTSW	4	113238103	missense	probably benign	0.20
R1132:Skint6	UTSW	4	112898099	critical splice donor site	probably null
R1228:Skint6	UTSW	4	112854452	missense	probably benign
R1338:Skint6	UTSW	4	113012961	missense	possibly damaging	0.53
R1432:Skint6	UTSW	4	112869524	splice site	probably benign
R1512:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R1577:Skint6	UTSW	4	113148523	missense	possibly damaging	0.53
R1733:Skint6	UTSW	4	113177037	splice site	probably benign
R1762:Skint6	UTSW	4	113236481	missense	probably damaging	0.98
R1891:Skint6	UTSW	4	112846696	missense	possibly damaging	0.85
R1908:Skint6	UTSW	4	112891990	missense	probably benign
R2069:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R2089:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2144:Skint6	UTSW	4	113236260	missense	possibly damaging	0.84
R2166:Skint6	UTSW	4	112854452	missense	probably benign	0.01
R2192:Skint6	UTSW	4	112865712	nonsense	probably null
R2267:Skint6	UTSW	4	112842822	splice site	probably null
R2312:Skint6	UTSW	4	113238142	missense	probably damaging	1.00
R2324:Skint6	UTSW	4	112872457	splice site	probably null
R2342:Skint6	UTSW	4	113176983	missense	probably benign	0.00
R3028:Skint6	UTSW	4	113236493	missense	possibly damaging	0.92
R3704:Skint6	UTSW	4	113136472	missense	possibly damaging	0.86
R3752:Skint6	UTSW	4	112842899	splice site	probably benign
R3760:Skint6	UTSW	4	112937458	missense	possibly damaging	0.53
R3827:Skint6	UTSW	4	112937437	missense	probably benign
R4377:Skint6	UTSW	4	113236518	missense	possibly damaging	0.90
R4406:Skint6	UTSW	4	113156486	missense	probably benign	0.01
R4611:Skint6	UTSW	4	113074076	missense	probably benign
R4780:Skint6	UTSW	4	113236397	missense	probably damaging	0.98
R4788:Skint6	UTSW	4	113238336	missense	possibly damaging	0.54
R4818:Skint6	UTSW	4	112955392	intron	probably benign
R4900:Skint6	UTSW	4	113067470	missense	probably benign	0.03
R4972:Skint6	UTSW	4	112835068	missense	probably benign
R5008:Skint6	UTSW	4	112991255	missense	possibly damaging	0.86
R5016:Skint6	UTSW	4	113171533	critical splice acceptor site	probably null
R5085:Skint6	UTSW	4	113236268	missense	probably damaging	0.99
R5165:Skint6	UTSW	4	112865668	missense	possibly damaging	0.86
R5221:Skint6	UTSW	4	112894924	splice site	probably null
R5310:Skint6	UTSW	4	113184768	nonsense	probably null
R5423:Skint6	UTSW	4	112850740	missense	possibly damaging	0.93
R5436:Skint6	UTSW	4	113096591	missense	probably benign	0.08
R5447:Skint6	UTSW	4	113105909	missense	probably benign	0.34
R5564:Skint6	UTSW	4	112988965	missense	possibly damaging	0.72
R5629:Skint6	UTSW	4	113012979	missense	possibly damaging	0.86
R5936:Skint6	UTSW	4	113096593	missense	probably benign	0.33
R5993:Skint6	UTSW	4	112809079	missense	probably benign	0.02
R6027:Skint6	UTSW	4	113096564	splice site	probably null
R6174:Skint6	UTSW	4	112839313	missense	possibly damaging	0.53
R6497:Skint6	UTSW	4	113236398	missense	probably damaging	0.98
R6552:Skint6	UTSW	4	113067490	missense	possibly damaging	0.86
R6645:Skint6	UTSW	4	112892038	missense	possibly damaging	0.53
R6810:Skint6	UTSW	4	112948380	splice site	probably null
R7003:Skint6	UTSW	4	113105912	missense	probably benign	0.01
R7211:Skint6	UTSW	4	113238369	missense	probably benign	0.09
R7269:Skint6	UTSW	4	112854489	splice site	probably null
R7398:Skint6	UTSW	4	112898138	missense	probably benign	0.00
R7438:Skint6	UTSW	4	113238228	missense	probably damaging	1.00
R7461:Skint6	UTSW	4	113177046	splice site	probably null
R7536:Skint6	UTSW	4	112811547	critical splice acceptor site	probably null
R7613:Skint6	UTSW	4	113177046	splice site	probably null
R7956:Skint6	UTSW	4	112846697	missense	possibly damaging	0.85
R8118:Skint6	UTSW	4	112865675	missense	possibly damaging	0.53
R8118:Skint6	UTSW	4	113156494	missense	possibly damaging	0.73
R8197:Skint6	UTSW	4	112894843	splice site	probably null
R8218:Skint6	UTSW	4	112839274	splice site	probably null
R8344:Skint6	UTSW	4	113236445	missense	probably damaging	1.00
R8518:Skint6	UTSW	4	113238268	missense	possibly damaging	0.58
R8776:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8776-TAIL:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8794:Skint6	UTSW	4	113192672	missense	possibly damaging	0.73
R8796:Skint6	UTSW	4	112804694	missense	possibly damaging	0.86
R8812:Skint6	UTSW	4	112988952	missense	probably benign	0.00
R8866:Skint6	UTSW	4	112854453	missense	probably benign
R8881:Skint6	UTSW	4	112815519	missense	possibly damaging	0.53
R8949:Skint6	UTSW	4	113074099	missense	probably benign	0.04
R8967:Skint6	UTSW	4	112872504	nonsense	probably null
R9005:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9007:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9053:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9055:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9144:Skint6	UTSW	4	113127905	missense	possibly damaging	0.73
R9297:Skint6	UTSW	4	112811520	missense	probably benign	0.00
R9388:Skint6	UTSW	4	113192641	missense	possibly damaging	0.85
R9407:Skint6	UTSW	4	113177027	missense	possibly damaging	0.53
R9475:Skint6	UTSW	4	112806840	critical splice donor site	probably null
R9515:Skint6	UTSW	4	112858178	missense	probably benign
R9572:Skint6	UTSW	4	113127931	missense	probably benign
R9689:Skint6	UTSW	4	113236349	missense	probably damaging	0.99
R9744:Skint6	UTSW	4	112809163	missense	probably damaging	1.00
R9785:Skint6	UTSW	4	112883687	missense	possibly damaging	0.86
Z1176:Skint6	UTSW	4	112892014	missense	possibly damaging	0.53
Z1176:Skint6	UTSW	4	113238294	missense	probably damaging	0.96
Z1176:Skint6	UTSW	4	113238295	missense	possibly damaging	0.83
Z1177:Skint6	UTSW	4	112806928	missense	possibly damaging	0.96
Z1177:Skint6	UTSW	4	113105961	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTCCTACTTCAATCAAGCC -3'
(R):5'- ACAAGAGGGATAAACAAGATATTTCC -3'

Sequencing Primer
(F):5'- AATCAAGCCTCTTATTTCAAGGCC -3'
(R):5'- TCCTGGCTAGAGGACTCACAG -3'

Posted On

2022-01-20