Mutagenetix > Incidental Mutation

Incidental Mutation 'R9149:Lmod3'

694887

Institutional Source

Beutler Lab

Gene Symbol

Lmod3

Ensembl Gene

ENSMUSG00000044086

Gene Name

leiomodin 3 (fetal)

Synonyms

5430424A14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R9149 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

97238534-97252759 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 97247664 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 399 (N399D)

Ref Sequence

ENSEMBL: ENSMUSP00000093315 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095655]

AlphaFold

E9QA62

Predicted Effect

probably damaging
Transcript: ENSMUST00000095655
AA Change: N399D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093315
Gene: ENSMUSG00000044086
AA Change: N399D

Domain	Start	End	E-Value	Type
Pfam:Tropomodulin	8	177	1.2e-13	PFAM
PDB:1IO0\|A	248	406	9e-46	PDB
SCOP:d1a4ya_	261	358	1e-3	SMART
low complexity region	407	427	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (90/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leiomodin family of proteins. This protein contains three actin-binding domains, a tropomyosin domain, a leucine-rich repeat domain, and a Wiskott-Aldrich syndrome protein homology 2 domain (WH2). Localization of this protein to the pointed ends of thin filaments has been observed, and there is evidence that this protein acts as a catalyst of actin nucleation, and is important to the organization of sarcomeric thin filaments in skeletal muscles. Mutations in this gene have been associated as one cause of Nemaline myopathy, as other genes have also been linked to this disorder. Nemaline myopathy is a disorder characterized by nonprogressive generalized muscle weakness and protein inclusions (nemaline bodies) in skeletal myofibers. Patients with mutations in this gene often present with a severe congenital form of the disorder. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for an endonuclease-mediated mutation are runted and exhibit nemaline myopathy including a reduction in skeletal myofiber size, centrally nucleated skeletal muscle fibers, increase in skeletal muscle glycogen levels, and abnormal sarcomere and Z lines. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,446,304	S103N	probably benign	Het
Ace	A	G	11: 105,972,473	D358G	possibly damaging	Het
Acvr2b	A	T	9: 119,428,050	H115L	probably damaging	Het
Adam15	G	A	3: 89,347,435	T106I	possibly damaging	Het
Adamts16	A	G	13: 70,735,829	C1076R	probably damaging	Het
Adcy5	A	G	16: 35,272,111	Y614C	probably damaging	Het
Adhfe1	A	T	1: 9,557,051	H225L	probably benign	Het
Aff3	A	G	1: 38,181,316	I1171T	probably damaging	Het
Agps	T	A	2: 75,866,838	M334K	probably damaging	Het
Akr1e1	A	G	13: 4,602,679		probably null	Het
Als2cl	G	A	9: 110,889,123	V311M	probably benign	Het
Amdhd1	A	T	10: 93,539,951	L7H	probably damaging	Het
Apba1	A	T	19: 23,893,418	I205F	probably damaging	Het
Arhgap26	A	T	18: 39,111,864	E187D	possibly damaging	Het
Ash1l	A	T	3: 89,007,223	H1720L	probably benign	Het
Atp9a	T	C	2: 168,734,068		probably benign	Het
Bcl7c	G	A	7: 127,708,523	A2V	probably damaging	Het
Catsperg1	G	C	7: 29,210,487	P72R	probably benign	Het
Ccdc103	G	A	11: 102,884,096	G174R	probably benign	Het
Ccdc171	A	T	4: 83,694,275	K976M	probably damaging	Het
Ceacam1	T	C	7: 25,473,935	N276S	possibly damaging	Het
Cep152	T	C	2: 125,619,883	N91S	probably damaging	Het
Cep152	T	C	2: 125,621,207	E18G	probably damaging	Het
Cers3	T	C	7: 66,743,694	L17P	probably benign	Het
Cpsf3	A	G	12: 21,306,843	N489S	possibly damaging	Het
Cramp1l	A	G	17: 24,968,946	S1225P	probably damaging	Het
Dck	G	A	5: 88,765,307	G18R	probably benign	Het
Dnah5	A	T	15: 28,387,768	E3124D	probably benign	Het
Eogt	T	G	6: 97,113,878	L433F	probably damaging	Het
Fam135b	A	G	15: 71,462,895	S817P		Het
Fsip2	T	C	2: 82,982,030	Y2898H	possibly damaging	Het
Fzr1	T	C	10: 81,369,415	H249R	probably benign	Het
Gbp10	T	G	5: 105,218,995	Q457P	probably damaging	Het
Gin1	G	C	1: 97,783,094	L167F	probably damaging	Het
Gm14226	A	T	2: 155,024,923	I267F	probably damaging	Het
Gmnc	A	G	16: 26,962,892		probably null	Het
Hectd2	A	T	19: 36,599,002	I311F	probably damaging	Het
Heg1	A	G	16: 33,738,591	K1085E	probably benign	Het
Hmbs	G	A	9: 44,341,686	Q34*	probably null	Het
Hyal6	T	A	6: 24,734,152	M28K	probably benign	Het
Ifi27	T	C	12: 103,439,419	V141A	possibly damaging	Het
Ift122	T	A	6: 115,890,531	I414N	probably damaging	Het
Iglv2	A	T	16: 19,260,684	V23E	probably damaging	Het
Itgax	A	T	7: 128,131,469	I120L	probably benign	Het
Kifc3	A	G	8: 95,126,689	I13T	probably benign	Het
Macf1	A	T	4: 123,471,533	I3145K	probably benign	Het
Map2k5	A	C	9: 63,293,724	I209S	probably damaging	Het
Mbd5	A	G	2: 49,251,376	E117G	probably damaging	Het
Milr1	A	G	11: 106,761,279	H172R	probably benign	Het
Myod1	A	C	7: 46,377,169	D166A		Het
Neb	C	T	2: 52,210,866	V4647M	possibly damaging	Het
Nek1	A	T	8: 61,121,021	D1101V	probably damaging	Het
Nlrp2	A	T	7: 5,327,573	V608D	probably benign	Het
Noc3l	G	A	19: 38,812,391	Q216*	probably null	Het
Nos1	G	C	5: 117,879,337	R255P	probably benign	Het
Nup160	T	A	2: 90,722,241		probably benign	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Oat	C	T	7: 132,564,277	S193N	probably benign	Het
Olfr1	T	A	11: 73,396,027		probably benign	Het
Olfr1148	G	T	2: 87,833,179	G47*	probably null	Het
Olfr344	T	G	2: 36,568,976	F126C	probably benign	Het
Olfr776	A	G	10: 129,261,315	Y118C	probably damaging	Het
Olfr812	A	G	10: 129,842,613	V143A	probably damaging	Het
Oma1	A	G	4: 103,325,017		probably null	Het
Os9	A	G	10: 127,098,049	S500P	possibly damaging	Het
Osbpl11	A	T	16: 33,227,290	N541I		Het
Pcnx4	A	G	12: 72,566,897	I539V	probably benign	Het
Ppfia3	T	A	7: 45,350,293		probably null	Het
Ppp1r3a	T	C	6: 14,722,099	K275E	probably benign	Het
Pten	A	G	19: 32,792,572	N63S	probably benign	Het
Rptor	A	G	11: 119,887,070	N1020S	probably benign	Het
Sall2	C	A	14: 52,313,216	D841Y	possibly damaging	Het
Sbno1	T	A	5: 124,381,699	H1172L	probably benign	Het
Scaf4	A	T	16: 90,230,166	L921Q	probably damaging	Het
Sec22c	C	A	9: 121,695,684	R11L	probably damaging	Het
Skint6	T	A	4: 113,176,976	D318V	probably damaging	Het
Slc22a28	T	C	19: 8,071,840	N348S	probably benign	Het
Slc44a2	G	T	9: 21,342,009	K77N	possibly damaging	Het
Smc1b	C	T	15: 85,066,230	V1198I	probably benign	Het
Spef2	A	T	15: 9,717,482	M316K	probably damaging	Het
Stra8	T	C	6: 34,934,081	Y215H	probably damaging	Het
Sv2a	G	T	3: 96,189,694	R445L	probably benign	Het
Sycp1	A	C	3: 102,851,628	L771R	probably damaging	Het
Tchp	A	T	5: 114,721,123	R493*	probably null	Het
Ttc13	G	A	8: 124,683,300	A391V	probably benign	Het
Unc13b	C	T	4: 43,176,186	T2338I	unknown	Het
Wac	A	G	18: 7,921,592	D576G	probably damaging	Het
Wdr34	T	A	2: 30,033,941	T191S	probably benign	Het
Xdh	T	C	17: 73,915,693	N559S	probably benign	Het
Zscan20	A	T	4: 128,588,121	S583T	probably benign	Het

Other mutations in Lmod3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Lmod3	APN	6	97252297	missense	probably damaging	0.99
IGL00465:Lmod3	APN	6	97247861	missense	probably damaging	1.00
IGL01401:Lmod3	APN	6	97252552	missense	probably damaging	1.00
IGL02279:Lmod3	APN	6	97247672	missense	probably damaging	1.00
IGL02621:Lmod3	APN	6	97238835	utr 3 prime	probably benign
IGL03116:Lmod3	APN	6	97247195	missense	possibly damaging	0.92
Runted	UTSW	6	97247273	missense	probably damaging	1.00
R0086:Lmod3	UTSW	6	97247345	missense	probably damaging	1.00
R0627:Lmod3	UTSW	6	97248071	missense	probably damaging	0.96
R2208:Lmod3	UTSW	6	97247877	missense	probably benign	0.06
R4038:Lmod3	UTSW	6	97248314	missense	probably benign	0.06
R4913:Lmod3	UTSW	6	97247164	splice site	probably null
R5867:Lmod3	UTSW	6	97248002	missense	probably damaging	1.00
R5905:Lmod3	UTSW	6	97247614	missense	probably damaging	1.00
R6035:Lmod3	UTSW	6	97247273	missense	probably damaging	1.00
R6035:Lmod3	UTSW	6	97247273	missense	probably damaging	1.00
R6183:Lmod3	UTSW	6	97252553	missense	probably damaging	1.00
R6210:Lmod3	UTSW	6	97247301	missense	probably damaging	1.00
R6527:Lmod3	UTSW	6	97247378	missense	probably benign	0.00
R7225:Lmod3	UTSW	6	97247384	missense	probably benign	0.34
R7531:Lmod3	UTSW	6	97248442	missense	probably benign	0.01
R7908:Lmod3	UTSW	6	97248473	missense	probably benign	0.05
R8022:Lmod3	UTSW	6	97248299	missense	probably benign
R8154:Lmod3	UTSW	6	97247980	missense	probably damaging	1.00
R8325:Lmod3	UTSW	6	97247418	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GATGCAGGCTGGAAGAACTC -3'
(R):5'- AGTCCAACTTCATCACTGGG -3'

Sequencing Primer
(F):5'- AAGAACTCCTGCATTCTGGG -3'
(R):5'- TCCAACTTCATCACTGGGAAGGG -3'

Posted On

2022-01-20