Incidental Mutation 'R9149:Lmod3'
ID 694887
Institutional Source Beutler Lab
Gene Symbol Lmod3
Ensembl Gene ENSMUSG00000044086
Gene Name leiomodin 3 (fetal)
Synonyms 5430424A14Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R9149 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 97215495-97229720 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97224625 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 399 (N399D)
Ref Sequence ENSEMBL: ENSMUSP00000093315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095655]
AlphaFold E9QA62
Predicted Effect probably damaging
Transcript: ENSMUST00000095655
AA Change: N399D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093315
Gene: ENSMUSG00000044086
AA Change: N399D

DomainStartEndE-ValueType
Pfam:Tropomodulin 8 177 1.2e-13 PFAM
PDB:1IO0|A 248 406 9e-46 PDB
SCOP:d1a4ya_ 261 358 1e-3 SMART
low complexity region 407 427 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leiomodin family of proteins. This protein contains three actin-binding domains, a tropomyosin domain, a leucine-rich repeat domain, and a Wiskott-Aldrich syndrome protein homology 2 domain (WH2). Localization of this protein to the pointed ends of thin filaments has been observed, and there is evidence that this protein acts as a catalyst of actin nucleation, and is important to the organization of sarcomeric thin filaments in skeletal muscles. Mutations in this gene have been associated as one cause of Nemaline myopathy, as other genes have also been linked to this disorder. Nemaline myopathy is a disorder characterized by nonprogressive generalized muscle weakness and protein inclusions (nemaline bodies) in skeletal myofibers. Patients with mutations in this gene often present with a severe congenital form of the disorder. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for an endonuclease-mediated mutation are runted and exhibit nemaline myopathy including a reduction in skeletal myofiber size, centrally nucleated skeletal muscle fibers, increase in skeletal muscle glycogen levels, and abnormal sarcomere and Z lines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,396,304 (GRCm39) S103N probably benign Het
Ace A G 11: 105,863,299 (GRCm39) D358G possibly damaging Het
Acvr2b A T 9: 119,257,116 (GRCm39) H115L probably damaging Het
Adam15 G A 3: 89,254,742 (GRCm39) T106I possibly damaging Het
Adamts16 A G 13: 70,883,948 (GRCm39) C1076R probably damaging Het
Adcy5 A G 16: 35,092,481 (GRCm39) Y614C probably damaging Het
Adhfe1 A T 1: 9,627,276 (GRCm39) H225L probably benign Het
Aff3 A G 1: 38,220,397 (GRCm39) I1171T probably damaging Het
Agps T A 2: 75,697,182 (GRCm39) M334K probably damaging Het
Akr1e1 A G 13: 4,652,678 (GRCm39) probably null Het
Als2cl G A 9: 110,718,191 (GRCm39) V311M probably benign Het
Amdhd1 A T 10: 93,375,813 (GRCm39) L7H probably damaging Het
Apba1 A T 19: 23,870,782 (GRCm39) I205F probably damaging Het
Arhgap26 A T 18: 39,244,917 (GRCm39) E187D possibly damaging Het
Ash1l A T 3: 88,914,530 (GRCm39) H1720L probably benign Het
Atp9a T C 2: 168,575,988 (GRCm39) probably benign Het
Bcl7c G A 7: 127,307,695 (GRCm39) A2V probably damaging Het
Catsperg1 G C 7: 28,909,912 (GRCm39) P72R probably benign Het
Ccdc103 G A 11: 102,774,922 (GRCm39) G174R probably benign Het
Ccdc171 A T 4: 83,612,512 (GRCm39) K976M probably damaging Het
Ceacam1 T C 7: 25,173,360 (GRCm39) N276S possibly damaging Het
Cep152 T C 2: 125,463,127 (GRCm39) E18G probably damaging Het
Cep152 T C 2: 125,461,803 (GRCm39) N91S probably damaging Het
Cers3 T C 7: 66,393,442 (GRCm39) L17P probably benign Het
Cpsf3 A G 12: 21,356,844 (GRCm39) N489S possibly damaging Het
Cramp1 A G 17: 25,187,920 (GRCm39) S1225P probably damaging Het
Dck G A 5: 88,913,166 (GRCm39) G18R probably benign Het
Dnah5 A T 15: 28,387,914 (GRCm39) E3124D probably benign Het
Dync2i2 T A 2: 29,923,953 (GRCm39) T191S probably benign Het
Eogt T G 6: 97,090,839 (GRCm39) L433F probably damaging Het
Fam135b A G 15: 71,334,744 (GRCm39) S817P Het
Fsip2 T C 2: 82,812,374 (GRCm39) Y2898H possibly damaging Het
Fzr1 T C 10: 81,205,249 (GRCm39) H249R probably benign Het
Gbp10 T G 5: 105,366,861 (GRCm39) Q457P probably damaging Het
Gin1 G C 1: 97,710,819 (GRCm39) L167F probably damaging Het
Gm14226 A T 2: 154,866,843 (GRCm39) I267F probably damaging Het
Gmnc A G 16: 26,781,642 (GRCm39) probably null Het
Hectd2 A T 19: 36,576,402 (GRCm39) I311F probably damaging Het
Heg1 A G 16: 33,558,961 (GRCm39) K1085E probably benign Het
Hmbs G A 9: 44,252,983 (GRCm39) Q34* probably null Het
Hyal6 T A 6: 24,734,151 (GRCm39) M28K probably benign Het
Ifi27l2a T C 12: 103,405,678 (GRCm39) V141A possibly damaging Het
Ift122 T A 6: 115,867,492 (GRCm39) I414N probably damaging Het
Iglv2 A T 16: 19,079,434 (GRCm39) V23E probably damaging Het
Itgax A T 7: 127,730,641 (GRCm39) I120L probably benign Het
Kifc3 A G 8: 95,853,317 (GRCm39) I13T probably benign Het
Macf1 A T 4: 123,365,326 (GRCm39) I3145K probably benign Het
Map2k5 A C 9: 63,201,006 (GRCm39) I209S probably damaging Het
Mbd5 A G 2: 49,141,388 (GRCm39) E117G probably damaging Het
Milr1 A G 11: 106,652,105 (GRCm39) H172R probably benign Het
Myod1 A C 7: 46,026,593 (GRCm39) D166A Het
Neb C T 2: 52,100,878 (GRCm39) V4647M possibly damaging Het
Nek1 A T 8: 61,574,055 (GRCm39) D1101V probably damaging Het
Nlrp2 A T 7: 5,330,572 (GRCm39) V608D probably benign Het
Noc3l G A 19: 38,800,835 (GRCm39) Q216* probably null Het
Nos1 G C 5: 118,017,402 (GRCm39) R255P probably benign Het
Nup160 T A 2: 90,552,585 (GRCm39) probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Oat C T 7: 132,166,006 (GRCm39) S193N probably benign Het
Oma1 A G 4: 103,182,214 (GRCm39) probably null Het
Or12e13 G T 2: 87,663,523 (GRCm39) G47* probably null Het
Or1e16 T A 11: 73,286,853 (GRCm39) probably benign Het
Or1j15 T G 2: 36,458,988 (GRCm39) F126C probably benign Het
Or6c206 A G 10: 129,097,184 (GRCm39) Y118C probably damaging Het
Or6c216 A G 10: 129,678,482 (GRCm39) V143A probably damaging Het
Os9 A G 10: 126,933,918 (GRCm39) S500P possibly damaging Het
Osbpl11 A T 16: 33,047,660 (GRCm39) N541I Het
Pcnx4 A G 12: 72,613,671 (GRCm39) I539V probably benign Het
Ppfia3 T A 7: 44,999,717 (GRCm39) probably null Het
Ppp1r3a T C 6: 14,722,098 (GRCm39) K275E probably benign Het
Pten A G 19: 32,769,972 (GRCm39) N63S probably benign Het
Rptor A G 11: 119,777,896 (GRCm39) N1020S probably benign Het
Sall2 C A 14: 52,550,673 (GRCm39) D841Y possibly damaging Het
Sbno1 T A 5: 124,519,762 (GRCm39) H1172L probably benign Het
Scaf4 A T 16: 90,027,054 (GRCm39) L921Q probably damaging Het
Sec22c C A 9: 121,524,750 (GRCm39) R11L probably damaging Het
Skint6 T A 4: 113,034,173 (GRCm39) D318V probably damaging Het
Slc22a28 T C 19: 8,049,205 (GRCm39) N348S probably benign Het
Slc44a2 G T 9: 21,253,305 (GRCm39) K77N possibly damaging Het
Smc1b C T 15: 84,950,431 (GRCm39) V1198I probably benign Het
Spef2 A T 15: 9,717,568 (GRCm39) M316K probably damaging Het
Stra8 T C 6: 34,911,016 (GRCm39) Y215H probably damaging Het
Sv2a G T 3: 96,097,010 (GRCm39) R445L probably benign Het
Sycp1 A C 3: 102,758,944 (GRCm39) L771R probably damaging Het
Tchp A T 5: 114,859,184 (GRCm39) R493* probably null Het
Ttc13 G A 8: 125,410,039 (GRCm39) A391V probably benign Het
Unc13b C T 4: 43,176,186 (GRCm39) T2338I unknown Het
Wac A G 18: 7,921,592 (GRCm39) D576G probably damaging Het
Xdh T C 17: 74,222,688 (GRCm39) N559S probably benign Het
Zscan20 A T 4: 128,481,914 (GRCm39) S583T probably benign Het
Other mutations in Lmod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmod3 APN 6 97,229,258 (GRCm39) missense probably damaging 0.99
IGL00465:Lmod3 APN 6 97,224,822 (GRCm39) missense probably damaging 1.00
IGL01401:Lmod3 APN 6 97,229,513 (GRCm39) missense probably damaging 1.00
IGL02279:Lmod3 APN 6 97,224,633 (GRCm39) missense probably damaging 1.00
IGL02621:Lmod3 APN 6 97,215,796 (GRCm39) utr 3 prime probably benign
IGL03116:Lmod3 APN 6 97,224,156 (GRCm39) missense possibly damaging 0.92
Runted UTSW 6 97,224,234 (GRCm39) missense probably damaging 1.00
R0086:Lmod3 UTSW 6 97,224,306 (GRCm39) missense probably damaging 1.00
R0627:Lmod3 UTSW 6 97,225,032 (GRCm39) missense probably damaging 0.96
R2208:Lmod3 UTSW 6 97,224,838 (GRCm39) missense probably benign 0.06
R4038:Lmod3 UTSW 6 97,225,275 (GRCm39) missense probably benign 0.06
R4913:Lmod3 UTSW 6 97,224,125 (GRCm39) splice site probably null
R5867:Lmod3 UTSW 6 97,224,963 (GRCm39) missense probably damaging 1.00
R5905:Lmod3 UTSW 6 97,224,575 (GRCm39) missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97,224,234 (GRCm39) missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97,224,234 (GRCm39) missense probably damaging 1.00
R6183:Lmod3 UTSW 6 97,229,514 (GRCm39) missense probably damaging 1.00
R6210:Lmod3 UTSW 6 97,224,262 (GRCm39) missense probably damaging 1.00
R6527:Lmod3 UTSW 6 97,224,339 (GRCm39) missense probably benign 0.00
R7225:Lmod3 UTSW 6 97,224,345 (GRCm39) missense probably benign 0.34
R7531:Lmod3 UTSW 6 97,225,403 (GRCm39) missense probably benign 0.01
R7908:Lmod3 UTSW 6 97,225,434 (GRCm39) missense probably benign 0.05
R8022:Lmod3 UTSW 6 97,225,260 (GRCm39) missense probably benign
R8154:Lmod3 UTSW 6 97,224,941 (GRCm39) missense probably damaging 1.00
R8325:Lmod3 UTSW 6 97,224,379 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GATGCAGGCTGGAAGAACTC -3'
(R):5'- AGTCCAACTTCATCACTGGG -3'

Sequencing Primer
(F):5'- AAGAACTCCTGCATTCTGGG -3'
(R):5'- TCCAACTTCATCACTGGGAAGGG -3'
Posted On 2022-01-20