Incidental Mutation 'R9149:Ift122'
ID 694888
Institutional Source Beutler Lab
Gene Symbol Ift122
Ensembl Gene ENSMUSG00000030323
Gene Name intraflagellar transport 122
Synonyms C86139, sopb, Wdr10
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9149 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 115853470-115926699 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 115890531 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 414 (I414N)
Ref Sequence ENSEMBL: ENSMUSP00000108547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000141305]
AlphaFold Q6NWV3
Predicted Effect probably damaging
Transcript: ENSMUST00000038234
AA Change: I414N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323
AA Change: I414N

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323
AA Change: I473N

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
Blast:WD40 163 267 3e-46 BLAST
WD40 269 308 1.91e1 SMART
WD40 310 349 3.45e-3 SMART
WD40 507 542 1.43e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112925
AA Change: I414N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323
AA Change: I414N

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141305
SMART Domains Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
low complexity region 124 134 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This cytoplasmic protein contains seven WD repeats and an AF-2 domain which function by recruiting coregulatory molecules and in transcriptional activation. Mutations in this gene cause cranioectodermal dysplasia-1. A related pseudogene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null mutation display embryonic lethality during organogenesis with exencephaly, a ventralized caudal neural tube, preaxial polydactyly, abnormal cilia, and left-right patterning defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,446,304 S103N probably benign Het
Ace A G 11: 105,972,473 D358G possibly damaging Het
Acvr2b A T 9: 119,428,050 H115L probably damaging Het
Adam15 G A 3: 89,347,435 T106I possibly damaging Het
Adamts16 A G 13: 70,735,829 C1076R probably damaging Het
Adcy5 A G 16: 35,272,111 Y614C probably damaging Het
Adhfe1 A T 1: 9,557,051 H225L probably benign Het
Aff3 A G 1: 38,181,316 I1171T probably damaging Het
Agps T A 2: 75,866,838 M334K probably damaging Het
Akr1e1 A G 13: 4,602,679 probably null Het
Als2cl G A 9: 110,889,123 V311M probably benign Het
Amdhd1 A T 10: 93,539,951 L7H probably damaging Het
Apba1 A T 19: 23,893,418 I205F probably damaging Het
Arhgap26 A T 18: 39,111,864 E187D possibly damaging Het
Ash1l A T 3: 89,007,223 H1720L probably benign Het
Bcl7c G A 7: 127,708,523 A2V probably damaging Het
Catsperg1 G C 7: 29,210,487 P72R probably benign Het
Ccdc103 G A 11: 102,884,096 G174R probably benign Het
Ccdc171 A T 4: 83,694,275 K976M probably damaging Het
Ceacam1 T C 7: 25,473,935 N276S possibly damaging Het
Cep152 T C 2: 125,619,883 N91S probably damaging Het
Cep152 T C 2: 125,621,207 E18G probably damaging Het
Cers3 T C 7: 66,743,694 L17P probably benign Het
Cpsf3 A G 12: 21,306,843 N489S possibly damaging Het
Cramp1l A G 17: 24,968,946 S1225P probably damaging Het
Dck G A 5: 88,765,307 G18R probably benign Het
Dnah5 A T 15: 28,387,768 E3124D probably benign Het
Eogt T G 6: 97,113,878 L433F probably damaging Het
Fam135b A G 15: 71,462,895 S817P Het
Fsip2 T C 2: 82,982,030 Y2898H possibly damaging Het
Fzr1 T C 10: 81,369,415 H249R probably benign Het
Gbp10 T G 5: 105,218,995 Q457P probably damaging Het
Gin1 G C 1: 97,783,094 L167F probably damaging Het
Gm14226 A T 2: 155,024,923 I267F probably damaging Het
Gmnc A G 16: 26,962,892 probably null Het
Hectd2 A T 19: 36,599,002 I311F probably damaging Het
Heg1 A G 16: 33,738,591 K1085E probably benign Het
Hmbs G A 9: 44,341,686 Q34* probably null Het
Hyal6 T A 6: 24,734,152 M28K probably benign Het
Ifi27 T C 12: 103,439,419 V141A possibly damaging Het
Iglv2 A T 16: 19,260,684 V23E probably damaging Het
Itgax A T 7: 128,131,469 I120L probably benign Het
Kifc3 A G 8: 95,126,689 I13T probably benign Het
Lmod3 T C 6: 97,247,664 N399D probably damaging Het
Macf1 A T 4: 123,471,533 I3145K probably benign Het
Map2k5 A C 9: 63,293,724 I209S probably damaging Het
Mbd5 A G 2: 49,251,376 E117G probably damaging Het
Milr1 A G 11: 106,761,279 H172R probably benign Het
Myod1 A C 7: 46,377,169 D166A Het
Neb C T 2: 52,210,866 V4647M possibly damaging Het
Nek1 A T 8: 61,121,021 D1101V probably damaging Het
Nlrp2 A T 7: 5,327,573 V608D probably benign Het
Noc3l G A 19: 38,812,391 Q216* probably null Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Oat C T 7: 132,564,277 S193N probably benign Het
Olfr1 T A 11: 73,396,027 probably benign Het
Olfr1148 G T 2: 87,833,179 G47* probably null Het
Olfr344 T G 2: 36,568,976 F126C probably benign Het
Olfr776 A G 10: 129,261,315 Y118C probably damaging Het
Olfr812 A G 10: 129,842,613 V143A probably damaging Het
Oma1 A G 4: 103,325,017 probably null Het
Os9 A G 10: 127,098,049 S500P possibly damaging Het
Osbpl11 A T 16: 33,227,290 N541I Het
Pcnx4 A G 12: 72,566,897 I539V probably benign Het
Ppfia3 T A 7: 45,350,293 probably null Het
Ppp1r3a T C 6: 14,722,099 K275E probably benign Het
Pten A G 19: 32,792,572 N63S probably benign Het
Rptor A G 11: 119,887,070 N1020S probably benign Het
Sall2 C A 14: 52,313,216 D841Y possibly damaging Het
Sbno1 T A 5: 124,381,699 H1172L probably benign Het
Scaf4 A T 16: 90,230,166 L921Q probably damaging Het
Sec22c C A 9: 121,695,684 R11L probably damaging Het
Skint6 T A 4: 113,176,976 D318V probably damaging Het
Slc22a28 T C 19: 8,071,840 N348S probably benign Het
Slc44a2 G T 9: 21,342,009 K77N possibly damaging Het
Smc1b C T 15: 85,066,230 V1198I probably benign Het
Spef2 A T 15: 9,717,482 M316K probably damaging Het
Stra8 T C 6: 34,934,081 Y215H probably damaging Het
Sv2a G T 3: 96,189,694 R445L probably benign Het
Sycp1 A C 3: 102,851,628 L771R probably damaging Het
Tchp A T 5: 114,721,123 R493* probably null Het
Ttc13 G A 8: 124,683,300 A391V probably benign Het
Unc13b C T 4: 43,176,186 T2338I unknown Het
Wac A G 18: 7,921,592 D576G probably damaging Het
Wdr34 T A 2: 30,033,941 T191S probably benign Het
Xdh T C 17: 73,915,693 N559S probably benign Het
Zscan20 A T 4: 128,588,121 S583T probably benign Het
Other mutations in Ift122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ift122 APN 6 115917057 missense probably benign 0.10
IGL00783:Ift122 APN 6 115905902 missense probably benign
IGL00784:Ift122 APN 6 115905902 missense probably benign
IGL00799:Ift122 APN 6 115877536 missense probably damaging 1.00
IGL00908:Ift122 APN 6 115913909 missense probably benign 0.00
IGL01012:Ift122 APN 6 115899491 missense probably damaging 0.99
IGL01444:Ift122 APN 6 115884379 missense probably benign 0.08
IGL01451:Ift122 APN 6 115912604 critical splice donor site probably null
IGL01940:Ift122 APN 6 115887371 splice site probably benign
IGL02089:Ift122 APN 6 115925437 missense probably benign 0.00
IGL02331:Ift122 APN 6 115887324 missense probably damaging 1.00
IGL02929:Ift122 APN 6 115902877 missense probably damaging 1.00
IGL03169:Ift122 APN 6 115905961 splice site probably benign
PIT1430001:Ift122 UTSW 6 115925744 splice site probably benign
R0158:Ift122 UTSW 6 115924484 splice site probably benign
R0496:Ift122 UTSW 6 115905902 missense probably benign
R1065:Ift122 UTSW 6 115875325 splice site probably null
R1670:Ift122 UTSW 6 115923883 missense probably benign 0.05
R1861:Ift122 UTSW 6 115891928 missense probably damaging 1.00
R1889:Ift122 UTSW 6 115894421 critical splice donor site probably null
R1990:Ift122 UTSW 6 115924367 missense probably damaging 1.00
R2362:Ift122 UTSW 6 115884350 missense probably damaging 0.99
R2385:Ift122 UTSW 6 115912522 missense probably benign 0.21
R3734:Ift122 UTSW 6 115925501 splice site probably benign
R3800:Ift122 UTSW 6 115925906 missense probably benign 0.03
R3981:Ift122 UTSW 6 115913921 missense probably benign 0.02
R4289:Ift122 UTSW 6 115923891 missense probably damaging 1.00
R4545:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4546:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4641:Ift122 UTSW 6 115888765 nonsense probably null
R4815:Ift122 UTSW 6 115881556 missense possibly damaging 0.95
R4854:Ift122 UTSW 6 115862746 missense possibly damaging 0.61
R4928:Ift122 UTSW 6 115915858 utr 3 prime probably benign
R5021:Ift122 UTSW 6 115864372 missense probably benign 0.41
R5121:Ift122 UTSW 6 115912534 missense probably benign 0.04
R5200:Ift122 UTSW 6 115920379 missense probably damaging 0.99
R5549:Ift122 UTSW 6 115892022 missense probably damaging 1.00
R6111:Ift122 UTSW 6 115875286 missense probably damaging 1.00
R6141:Ift122 UTSW 6 115916011 missense probably damaging 0.99
R6766:Ift122 UTSW 6 115926243 missense probably benign 0.15
R7379:Ift122 UTSW 6 115926302 missense probably benign
R7402:Ift122 UTSW 6 115894322 missense probably benign 0.00
R7436:Ift122 UTSW 6 115926302 missense probably benign
R7437:Ift122 UTSW 6 115926302 missense probably benign
R7438:Ift122 UTSW 6 115926302 missense probably benign
R7517:Ift122 UTSW 6 115890582 missense probably benign 0.37
R7978:Ift122 UTSW 6 115920352 missense probably benign 0.37
R8492:Ift122 UTSW 6 115887005 missense probably benign 0.02
R8493:Ift122 UTSW 6 115910331 missense probably benign 0.01
R8669:Ift122 UTSW 6 115923291 missense probably damaging 0.98
R8867:Ift122 UTSW 6 115880671 missense probably damaging 1.00
R8887:Ift122 UTSW 6 115891919 missense probably benign 0.00
R8947:Ift122 UTSW 6 115924407 missense probably benign
R8978:Ift122 UTSW 6 115925808 missense possibly damaging 0.78
Z1176:Ift122 UTSW 6 115915994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGAGCCAGCGTTAGATCAC -3'
(R):5'- GAGCATGCTGTGAGTCTGAG -3'

Sequencing Primer
(F):5'- AGCGTTAGATCACCACTGCTG -3'
(R):5'- CTGTCTTTATGAAAGCAAACGCCAG -3'
Posted On 2022-01-20