Incidental Mutation 'R9149:Nlrp2'
ID 694889
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene Name NLR family, pyrin domain containing 2
Synonyms Nbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9149 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 5298547-5351035 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 5327573 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 608 (V608D)
Ref Sequence ENSEMBL: ENSMUSP00000045077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022]
AlphaFold Q4PLS0
Predicted Effect probably benign
Transcript: ENSMUST00000045022
AA Change: V608D

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: V608D

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,446,304 S103N probably benign Het
Ace A G 11: 105,972,473 D358G possibly damaging Het
Acvr2b A T 9: 119,428,050 H115L probably damaging Het
Adam15 G A 3: 89,347,435 T106I possibly damaging Het
Adamts16 A G 13: 70,735,829 C1076R probably damaging Het
Adcy5 A G 16: 35,272,111 Y614C probably damaging Het
Adhfe1 A T 1: 9,557,051 H225L probably benign Het
Aff3 A G 1: 38,181,316 I1171T probably damaging Het
Agps T A 2: 75,866,838 M334K probably damaging Het
Akr1e1 A G 13: 4,602,679 probably null Het
Als2cl G A 9: 110,889,123 V311M probably benign Het
Amdhd1 A T 10: 93,539,951 L7H probably damaging Het
Apba1 A T 19: 23,893,418 I205F probably damaging Het
Arhgap26 A T 18: 39,111,864 E187D possibly damaging Het
Ash1l A T 3: 89,007,223 H1720L probably benign Het
Bcl7c G A 7: 127,708,523 A2V probably damaging Het
Catsperg1 G C 7: 29,210,487 P72R probably benign Het
Ccdc103 G A 11: 102,884,096 G174R probably benign Het
Ccdc171 A T 4: 83,694,275 K976M probably damaging Het
Ceacam1 T C 7: 25,473,935 N276S possibly damaging Het
Cep152 T C 2: 125,619,883 N91S probably damaging Het
Cep152 T C 2: 125,621,207 E18G probably damaging Het
Cers3 T C 7: 66,743,694 L17P probably benign Het
Cpsf3 A G 12: 21,306,843 N489S possibly damaging Het
Cramp1l A G 17: 24,968,946 S1225P probably damaging Het
Dck G A 5: 88,765,307 G18R probably benign Het
Dnah5 A T 15: 28,387,768 E3124D probably benign Het
Eogt T G 6: 97,113,878 L433F probably damaging Het
Fam135b A G 15: 71,462,895 S817P Het
Fsip2 T C 2: 82,982,030 Y2898H possibly damaging Het
Fzr1 T C 10: 81,369,415 H249R probably benign Het
Gbp10 T G 5: 105,218,995 Q457P probably damaging Het
Gin1 G C 1: 97,783,094 L167F probably damaging Het
Gm14226 A T 2: 155,024,923 I267F probably damaging Het
Gmnc A G 16: 26,962,892 probably null Het
Hectd2 A T 19: 36,599,002 I311F probably damaging Het
Heg1 A G 16: 33,738,591 K1085E probably benign Het
Hmbs G A 9: 44,341,686 Q34* probably null Het
Hyal6 T A 6: 24,734,152 M28K probably benign Het
Ifi27 T C 12: 103,439,419 V141A possibly damaging Het
Ift122 T A 6: 115,890,531 I414N probably damaging Het
Iglv2 A T 16: 19,260,684 V23E probably damaging Het
Itgax A T 7: 128,131,469 I120L probably benign Het
Kifc3 A G 8: 95,126,689 I13T probably benign Het
Lmod3 T C 6: 97,247,664 N399D probably damaging Het
Macf1 A T 4: 123,471,533 I3145K probably benign Het
Map2k5 A C 9: 63,293,724 I209S probably damaging Het
Mbd5 A G 2: 49,251,376 E117G probably damaging Het
Milr1 A G 11: 106,761,279 H172R probably benign Het
Myod1 A C 7: 46,377,169 D166A Het
Neb C T 2: 52,210,866 V4647M possibly damaging Het
Nek1 A T 8: 61,121,021 D1101V probably damaging Het
Noc3l G A 19: 38,812,391 Q216* probably null Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Oat C T 7: 132,564,277 S193N probably benign Het
Olfr1 T A 11: 73,396,027 probably benign Het
Olfr1148 G T 2: 87,833,179 G47* probably null Het
Olfr344 T G 2: 36,568,976 F126C probably benign Het
Olfr776 A G 10: 129,261,315 Y118C probably damaging Het
Olfr812 A G 10: 129,842,613 V143A probably damaging Het
Oma1 A G 4: 103,325,017 probably null Het
Os9 A G 10: 127,098,049 S500P possibly damaging Het
Osbpl11 A T 16: 33,227,290 N541I Het
Pcnx4 A G 12: 72,566,897 I539V probably benign Het
Ppfia3 T A 7: 45,350,293 probably null Het
Ppp1r3a T C 6: 14,722,099 K275E probably benign Het
Pten A G 19: 32,792,572 N63S probably benign Het
Rptor A G 11: 119,887,070 N1020S probably benign Het
Sall2 C A 14: 52,313,216 D841Y possibly damaging Het
Sbno1 T A 5: 124,381,699 H1172L probably benign Het
Scaf4 A T 16: 90,230,166 L921Q probably damaging Het
Sec22c C A 9: 121,695,684 R11L probably damaging Het
Skint6 T A 4: 113,176,976 D318V probably damaging Het
Slc22a28 T C 19: 8,071,840 N348S probably benign Het
Slc44a2 G T 9: 21,342,009 K77N possibly damaging Het
Smc1b C T 15: 85,066,230 V1198I probably benign Het
Spef2 A T 15: 9,717,482 M316K probably damaging Het
Stra8 T C 6: 34,934,081 Y215H probably damaging Het
Sv2a G T 3: 96,189,694 R445L probably benign Het
Sycp1 A C 3: 102,851,628 L771R probably damaging Het
Tchp A T 5: 114,721,123 R493* probably null Het
Ttc13 G A 8: 124,683,300 A391V probably benign Het
Unc13b C T 4: 43,176,186 T2338I unknown Het
Wac A G 18: 7,921,592 D576G probably damaging Het
Wdr34 T A 2: 30,033,941 T191S probably benign Het
Xdh T C 17: 73,915,693 N559S probably benign Het
Zscan20 A T 4: 128,588,121 S583T probably benign Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5337548 missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5328252 missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5319239 missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5317492 missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5337770 missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5328035 missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5327823 missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5328810 missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5335567 critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5327552 nonsense probably null
IGL02803:Nlrp2 APN 7 5328318 missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5301025 missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5317483 missense probably damaging 1.00
BB006:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
BB016:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5322334 unclassified probably benign
R0079:Nlrp2 UTSW 7 5327730 missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5322418 missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5308770 missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5328329 missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5328109 missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5328545 missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5317630 missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5319222 missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5328431 missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5327491 missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5329015 splice site probably benign
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5308725 missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5327716 nonsense probably null
R1942:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5325006 missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5325042 missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5319238 missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5335598 missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5328129 missense probably benign
R2334:Nlrp2 UTSW 7 5337535 missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5327748 missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5319287 missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5327552 nonsense probably null
R4021:Nlrp2 UTSW 7 5325012 missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5325056 missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5319189 missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5328024 missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5328951 missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5328077 missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5327615 missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5325008 missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5328119 missense probably benign
R5390:Nlrp2 UTSW 7 5300909 missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5322381 missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5324903 splice site probably null
R6173:Nlrp2 UTSW 7 5337809 missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5317555 missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5337761 missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5300926 missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5325041 nonsense probably null
R6814:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5328229 nonsense probably null
R7028:Nlrp2 UTSW 7 5328572 missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5328617 missense probably damaging 1.00
R7203:Nlrp2 UTSW 7 5317534 missense probably damaging 1.00
R7322:Nlrp2 UTSW 7 5308645 missense possibly damaging 0.94
R7339:Nlrp2 UTSW 7 5327628 missense possibly damaging 0.95
R7573:Nlrp2 UTSW 7 5317469 critical splice donor site probably null
R7657:Nlrp2 UTSW 7 5319168 missense probably benign 0.01
R7929:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
R7964:Nlrp2 UTSW 7 5328528 missense probably damaging 1.00
R8097:Nlrp2 UTSW 7 5327651 missense probably damaging 1.00
R8276:Nlrp2 UTSW 7 5317495 missense probably benign 0.40
R8785:Nlrp2 UTSW 7 5327549 missense probably damaging 0.99
R8798:Nlrp2 UTSW 7 5327888 missense possibly damaging 0.86
R8982:Nlrp2 UTSW 7 5324979 missense probably damaging 1.00
R9030:Nlrp2 UTSW 7 5322458 missense probably null 0.00
R9038:Nlrp2 UTSW 7 5327479 missense probably benign 0.14
R9229:Nlrp2 UTSW 7 5301053 missense possibly damaging 0.81
X0027:Nlrp2 UTSW 7 5327642 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCAAGGAAGTAGGGTTCTTAC -3'
(R):5'- CATGCTTTCAAGGGAAGCAAG -3'

Sequencing Primer
(F):5'- CAAGGAAGTAGGGTTCTTACCTTTG -3'
(R):5'- ATTTGGCCTCCTGAATGAGAC -3'
Posted On 2022-01-20