Mutagenetix > Incidental Mutation

Incidental Mutation 'R9149:Itgax'

694896

Institutional Source

Beutler Lab

Gene Symbol

Itgax

Ensembl Gene

ENSMUSG00000030789

Gene Name

integrin alpha X

Synonyms

Cd11c, CD11C (p150) alpha polypeptide

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R9149 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128129547-128150657 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 128131469 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 120 (I120L)

Ref Sequence

ENSEMBL: ENSMUSP00000033053 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033053] [ENSMUST00000098015] [ENSMUST00000205460]

AlphaFold

Q9QXH4

Predicted Effect

probably benign
Transcript: ENSMUST00000033053
AA Change: I120L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: I120L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Int_alpha	33	83	1.28e1	SMART
VWA	150	331	8.36e-43	SMART
Int_alpha	402	451	3.67e-3	SMART
Int_alpha	455	512	1.29e-7	SMART
Int_alpha	518	574	5.72e-14	SMART
Int_alpha	581	635	1.55e-1	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	6.2e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098015

SMART Domains

Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Int_alpha	30	80	8.11e0	SMART
VWA	148	333	2.63e-49	SMART
Int_alpha	400	449	1.07e1	SMART
Int_alpha	453	510	1.48e-7	SMART
Int_alpha	516	572	4.9e-13	SMART
Int_alpha	579	633	3.67e-3	SMART
low complexity region	849	855	N/A	INTRINSIC
coiled coil region	1143	1170	N/A	INTRINSIC
low complexity region	1178	1200	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000134694

SMART Domains

Protein: ENSMUSP00000117120
Gene: ENSMUSG00000108596

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L29	39	82	1.1e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205460
AA Change: I120L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (90/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,446,304	S103N	probably benign	Het
Ace	A	G	11: 105,972,473	D358G	possibly damaging	Het
Acvr2b	A	T	9: 119,428,050	H115L	probably damaging	Het
Adam15	G	A	3: 89,347,435	T106I	possibly damaging	Het
Adamts16	A	G	13: 70,735,829	C1076R	probably damaging	Het
Adcy5	A	G	16: 35,272,111	Y614C	probably damaging	Het
Adhfe1	A	T	1: 9,557,051	H225L	probably benign	Het
Aff3	A	G	1: 38,181,316	I1171T	probably damaging	Het
Agps	T	A	2: 75,866,838	M334K	probably damaging	Het
Akr1e1	A	G	13: 4,602,679		probably null	Het
Als2cl	G	A	9: 110,889,123	V311M	probably benign	Het
Amdhd1	A	T	10: 93,539,951	L7H	probably damaging	Het
Apba1	A	T	19: 23,893,418	I205F	probably damaging	Het
Arhgap26	A	T	18: 39,111,864	E187D	possibly damaging	Het
Ash1l	A	T	3: 89,007,223	H1720L	probably benign	Het
Atp9a	T	C	2: 168,734,068		probably benign	Het
Bcl7c	G	A	7: 127,708,523	A2V	probably damaging	Het
Catsperg1	G	C	7: 29,210,487	P72R	probably benign	Het
Ccdc103	G	A	11: 102,884,096	G174R	probably benign	Het
Ccdc171	A	T	4: 83,694,275	K976M	probably damaging	Het
Ceacam1	T	C	7: 25,473,935	N276S	possibly damaging	Het
Cep152	T	C	2: 125,619,883	N91S	probably damaging	Het
Cep152	T	C	2: 125,621,207	E18G	probably damaging	Het
Cers3	T	C	7: 66,743,694	L17P	probably benign	Het
Cpsf3	A	G	12: 21,306,843	N489S	possibly damaging	Het
Cramp1l	A	G	17: 24,968,946	S1225P	probably damaging	Het
Dck	G	A	5: 88,765,307	G18R	probably benign	Het
Dnah5	A	T	15: 28,387,768	E3124D	probably benign	Het
Eogt	T	G	6: 97,113,878	L433F	probably damaging	Het
Fam135b	A	G	15: 71,462,895	S817P		Het
Fsip2	T	C	2: 82,982,030	Y2898H	possibly damaging	Het
Fzr1	T	C	10: 81,369,415	H249R	probably benign	Het
Gbp10	T	G	5: 105,218,995	Q457P	probably damaging	Het
Gin1	G	C	1: 97,783,094	L167F	probably damaging	Het
Gm14226	A	T	2: 155,024,923	I267F	probably damaging	Het
Gmnc	A	G	16: 26,962,892		probably null	Het
Hectd2	A	T	19: 36,599,002	I311F	probably damaging	Het
Heg1	A	G	16: 33,738,591	K1085E	probably benign	Het
Hmbs	G	A	9: 44,341,686	Q34*	probably null	Het
Hyal6	T	A	6: 24,734,152	M28K	probably benign	Het
Ifi27	T	C	12: 103,439,419	V141A	possibly damaging	Het
Ift122	T	A	6: 115,890,531	I414N	probably damaging	Het
Iglv2	A	T	16: 19,260,684	V23E	probably damaging	Het
Kifc3	A	G	8: 95,126,689	I13T	probably benign	Het
Lmod3	T	C	6: 97,247,664	N399D	probably damaging	Het
Macf1	A	T	4: 123,471,533	I3145K	probably benign	Het
Map2k5	A	C	9: 63,293,724	I209S	probably damaging	Het
Mbd5	A	G	2: 49,251,376	E117G	probably damaging	Het
Milr1	A	G	11: 106,761,279	H172R	probably benign	Het
Myod1	A	C	7: 46,377,169	D166A		Het
Neb	C	T	2: 52,210,866	V4647M	possibly damaging	Het
Nek1	A	T	8: 61,121,021	D1101V	probably damaging	Het
Nlrp2	A	T	7: 5,327,573	V608D	probably benign	Het
Noc3l	G	A	19: 38,812,391	Q216*	probably null	Het
Nos1	G	C	5: 117,879,337	R255P	probably benign	Het
Nup160	T	A	2: 90,722,241		probably benign	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Oat	C	T	7: 132,564,277	S193N	probably benign	Het
Olfr1	T	A	11: 73,396,027		probably benign	Het
Olfr1148	G	T	2: 87,833,179	G47*	probably null	Het
Olfr344	T	G	2: 36,568,976	F126C	probably benign	Het
Olfr776	A	G	10: 129,261,315	Y118C	probably damaging	Het
Olfr812	A	G	10: 129,842,613	V143A	probably damaging	Het
Oma1	A	G	4: 103,325,017		probably null	Het
Os9	A	G	10: 127,098,049	S500P	possibly damaging	Het
Osbpl11	A	T	16: 33,227,290	N541I		Het
Pcnx4	A	G	12: 72,566,897	I539V	probably benign	Het
Ppfia3	T	A	7: 45,350,293		probably null	Het
Ppp1r3a	T	C	6: 14,722,099	K275E	probably benign	Het
Pten	A	G	19: 32,792,572	N63S	probably benign	Het
Rptor	A	G	11: 119,887,070	N1020S	probably benign	Het
Sall2	C	A	14: 52,313,216	D841Y	possibly damaging	Het
Sbno1	T	A	5: 124,381,699	H1172L	probably benign	Het
Scaf4	A	T	16: 90,230,166	L921Q	probably damaging	Het
Sec22c	C	A	9: 121,695,684	R11L	probably damaging	Het
Skint6	T	A	4: 113,176,976	D318V	probably damaging	Het
Slc22a28	T	C	19: 8,071,840	N348S	probably benign	Het
Slc44a2	G	T	9: 21,342,009	K77N	possibly damaging	Het
Smc1b	C	T	15: 85,066,230	V1198I	probably benign	Het
Spef2	A	T	15: 9,717,482	M316K	probably damaging	Het
Stra8	T	C	6: 34,934,081	Y215H	probably damaging	Het
Sv2a	G	T	3: 96,189,694	R445L	probably benign	Het
Sycp1	A	C	3: 102,851,628	L771R	probably damaging	Het
Tchp	A	T	5: 114,721,123	R493*	probably null	Het
Ttc13	G	A	8: 124,683,300	A391V	probably benign	Het
Unc13b	C	T	4: 43,176,186	T2338I	unknown	Het
Wac	A	G	18: 7,921,592	D576G	probably damaging	Het
Wdr34	T	A	2: 30,033,941	T191S	probably benign	Het
Xdh	T	C	17: 73,915,693	N559S	probably benign	Het
Zscan20	A	T	4: 128,588,121	S583T	probably benign	Het

Other mutations in Itgax

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Itgax	APN	7	128135326	missense	probably damaging	1.00
IGL00325:Itgax	APN	7	128148309	missense	possibly damaging	0.69
IGL01155:Itgax	APN	7	128145035	missense	probably benign	0.00
IGL01461:Itgax	APN	7	128135018	missense	probably damaging	1.00
IGL01508:Itgax	APN	7	128144818	missense	probably damaging	1.00
IGL01549:Itgax	APN	7	128131206	splice site	probably null
IGL01864:Itgax	APN	7	128133763	missense	probably benign	0.00
IGL02094:Itgax	APN	7	128131473	missense	probably damaging	1.00
IGL02364:Itgax	APN	7	128139982	missense	possibly damaging	0.89
IGL02969:Itgax	APN	7	128149123	missense	probably benign
IGL03406:Itgax	APN	7	128149198	missense	possibly damaging	0.93
Adendritic	UTSW	7	128148572	nonsense	probably null
PIT4651001:Itgax	UTSW	7	128149110	missense	probably benign	0.11
R0366:Itgax	UTSW	7	128149089	splice site	probably benign
R0763:Itgax	UTSW	7	128147940	splice site	probably benign
R1072:Itgax	UTSW	7	128150144	missense	probably damaging	0.96
R1659:Itgax	UTSW	7	128130891	missense	probably benign	0.15
R2019:Itgax	UTSW	7	128148526	missense	probably benign
R2418:Itgax	UTSW	7	128142333	missense	probably damaging	0.98
R3027:Itgax	UTSW	7	128148572	nonsense	probably null
R3846:Itgax	UTSW	7	128133767	missense	probably damaging	1.00
R3938:Itgax	UTSW	7	128136273	missense	possibly damaging	0.73
R4021:Itgax	UTSW	7	128133139	critical splice donor site	probably null
R4027:Itgax	UTSW	7	128141266	missense	possibly damaging	0.75
R4163:Itgax	UTSW	7	128144700	missense	probably benign	0.00
R4923:Itgax	UTSW	7	128148528	missense	probably benign
R5259:Itgax	UTSW	7	128148278	missense	probably damaging	0.99
R5333:Itgax	UTSW	7	128142283	missense	probably damaging	1.00
R5347:Itgax	UTSW	7	128141302	missense	probably benign	0.08
R5679:Itgax	UTSW	7	128134990	missense	probably benign	0.00
R5725:Itgax	UTSW	7	128147861	missense	possibly damaging	0.63
R5733:Itgax	UTSW	7	128140475	missense	probably damaging	0.99
R5750:Itgax	UTSW	7	128144706	missense	probably benign	0.32
R5964:Itgax	UTSW	7	128140447	missense	probably damaging	1.00
R6004:Itgax	UTSW	7	128131452	missense	probably damaging	0.96
R6168:Itgax	UTSW	7	128133097	missense	probably damaging	0.99
R6212:Itgax	UTSW	7	128130332	missense	possibly damaging	0.52
R6212:Itgax	UTSW	7	128147853	missense	probably benign	0.16
R6480:Itgax	UTSW	7	128148599	missense	probably benign	0.12
R6484:Itgax	UTSW	7	128133718	missense	probably benign	0.13
R6796:Itgax	UTSW	7	128135064	missense	probably damaging	1.00
R6844:Itgax	UTSW	7	128147934	splice site	probably null
R7287:Itgax	UTSW	7	128148505	missense	probably damaging	1.00
R7365:Itgax	UTSW	7	128135309	missense	probably damaging	1.00
R7421:Itgax	UTSW	7	128140432	missense	probably damaging	1.00
R7599:Itgax	UTSW	7	128148090	missense	probably damaging	0.99
R7710:Itgax	UTSW	7	128135856	missense	probably benign	0.04
R7964:Itgax	UTSW	7	128140418	critical splice acceptor site	probably null
R8220:Itgax	UTSW	7	128130918	missense	probably benign	0.00
R8730:Itgax	UTSW	7	128139894	critical splice acceptor site	probably null
R8742:Itgax	UTSW	7	128144623	missense	probably benign	0.28
R8812:Itgax	UTSW	7	128133807	missense	probably damaging	1.00
R8871:Itgax	UTSW	7	128136051	missense	probably damaging	1.00
R9147:Itgax	UTSW	7	128148741	missense	possibly damaging	0.74
R9310:Itgax	UTSW	7	128142260	nonsense	probably null
R9376:Itgax	UTSW	7	128148763	missense	possibly damaging	0.94
R9377:Itgax	UTSW	7	128133677	missense	probably benign	0.03
R9641:Itgax	UTSW	7	128141980	missense	probably damaging	1.00
R9650:Itgax	UTSW	7	128135763	missense	probably benign	0.24
R9709:Itgax	UTSW	7	128136328	missense	probably damaging	1.00
X0061:Itgax	UTSW	7	128129607	start gained	probably benign
Z1176:Itgax	UTSW	7	128144872	missense	probably benign	0.24
Z1177:Itgax	UTSW	7	128148062	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TGAACATATCCCTGGGCCTG -3'
(R):5'- AGGATCTCTCCAGCTGTACC -3'

Sequencing Primer
(F):5'- AACCCTTCCTGGCTGTTGGTG -3'
(R):5'- GTACCGTCTGGCAATATATTTTCCAG -3'

Posted On

2022-01-20