Incidental Mutation 'R9149:Itgax'
ID 694896
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Name integrin alpha X
Synonyms CD11C (p150) alpha polypeptide, CR4, Cd11c
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R9149 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 127728719-127749829 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 127730641 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 120 (I120L)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053] [ENSMUST00000098015] [ENSMUST00000205460]
AlphaFold Q9QXH4
Predicted Effect probably benign
Transcript: ENSMUST00000033053
AA Change: I120L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: I120L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098015
SMART Domains Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
coiled coil region 1143 1170 N/A INTRINSIC
low complexity region 1178 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134694
SMART Domains Protein: ENSMUSP00000117120
Gene: ENSMUSG00000108596

DomainStartEndE-ValueType
Pfam:Ribosomal_L29 39 82 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205460
AA Change: I120L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,396,304 (GRCm39) S103N probably benign Het
Ace A G 11: 105,863,299 (GRCm39) D358G possibly damaging Het
Acvr2b A T 9: 119,257,116 (GRCm39) H115L probably damaging Het
Adam15 G A 3: 89,254,742 (GRCm39) T106I possibly damaging Het
Adamts16 A G 13: 70,883,948 (GRCm39) C1076R probably damaging Het
Adcy5 A G 16: 35,092,481 (GRCm39) Y614C probably damaging Het
Adhfe1 A T 1: 9,627,276 (GRCm39) H225L probably benign Het
Aff3 A G 1: 38,220,397 (GRCm39) I1171T probably damaging Het
Agps T A 2: 75,697,182 (GRCm39) M334K probably damaging Het
Akr1e1 A G 13: 4,652,678 (GRCm39) probably null Het
Als2cl G A 9: 110,718,191 (GRCm39) V311M probably benign Het
Amdhd1 A T 10: 93,375,813 (GRCm39) L7H probably damaging Het
Apba1 A T 19: 23,870,782 (GRCm39) I205F probably damaging Het
Arhgap26 A T 18: 39,244,917 (GRCm39) E187D possibly damaging Het
Ash1l A T 3: 88,914,530 (GRCm39) H1720L probably benign Het
Atp9a T C 2: 168,575,988 (GRCm39) probably benign Het
Bcl7c G A 7: 127,307,695 (GRCm39) A2V probably damaging Het
Catsperg1 G C 7: 28,909,912 (GRCm39) P72R probably benign Het
Ccdc103 G A 11: 102,774,922 (GRCm39) G174R probably benign Het
Ccdc171 A T 4: 83,612,512 (GRCm39) K976M probably damaging Het
Ceacam1 T C 7: 25,173,360 (GRCm39) N276S possibly damaging Het
Cep152 T C 2: 125,463,127 (GRCm39) E18G probably damaging Het
Cep152 T C 2: 125,461,803 (GRCm39) N91S probably damaging Het
Cers3 T C 7: 66,393,442 (GRCm39) L17P probably benign Het
Cpsf3 A G 12: 21,356,844 (GRCm39) N489S possibly damaging Het
Cramp1 A G 17: 25,187,920 (GRCm39) S1225P probably damaging Het
Dck G A 5: 88,913,166 (GRCm39) G18R probably benign Het
Dnah5 A T 15: 28,387,914 (GRCm39) E3124D probably benign Het
Dync2i2 T A 2: 29,923,953 (GRCm39) T191S probably benign Het
Eogt T G 6: 97,090,839 (GRCm39) L433F probably damaging Het
Fam135b A G 15: 71,334,744 (GRCm39) S817P Het
Fsip2 T C 2: 82,812,374 (GRCm39) Y2898H possibly damaging Het
Fzr1 T C 10: 81,205,249 (GRCm39) H249R probably benign Het
Gbp10 T G 5: 105,366,861 (GRCm39) Q457P probably damaging Het
Gin1 G C 1: 97,710,819 (GRCm39) L167F probably damaging Het
Gm14226 A T 2: 154,866,843 (GRCm39) I267F probably damaging Het
Gmnc A G 16: 26,781,642 (GRCm39) probably null Het
Hectd2 A T 19: 36,576,402 (GRCm39) I311F probably damaging Het
Heg1 A G 16: 33,558,961 (GRCm39) K1085E probably benign Het
Hmbs G A 9: 44,252,983 (GRCm39) Q34* probably null Het
Hyal6 T A 6: 24,734,151 (GRCm39) M28K probably benign Het
Ifi27l2a T C 12: 103,405,678 (GRCm39) V141A possibly damaging Het
Ift122 T A 6: 115,867,492 (GRCm39) I414N probably damaging Het
Iglv2 A T 16: 19,079,434 (GRCm39) V23E probably damaging Het
Kifc3 A G 8: 95,853,317 (GRCm39) I13T probably benign Het
Lmod3 T C 6: 97,224,625 (GRCm39) N399D probably damaging Het
Macf1 A T 4: 123,365,326 (GRCm39) I3145K probably benign Het
Map2k5 A C 9: 63,201,006 (GRCm39) I209S probably damaging Het
Mbd5 A G 2: 49,141,388 (GRCm39) E117G probably damaging Het
Milr1 A G 11: 106,652,105 (GRCm39) H172R probably benign Het
Myod1 A C 7: 46,026,593 (GRCm39) D166A Het
Neb C T 2: 52,100,878 (GRCm39) V4647M possibly damaging Het
Nek1 A T 8: 61,574,055 (GRCm39) D1101V probably damaging Het
Nlrp2 A T 7: 5,330,572 (GRCm39) V608D probably benign Het
Noc3l G A 19: 38,800,835 (GRCm39) Q216* probably null Het
Nos1 G C 5: 118,017,402 (GRCm39) R255P probably benign Het
Nup160 T A 2: 90,552,585 (GRCm39) probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Oat C T 7: 132,166,006 (GRCm39) S193N probably benign Het
Oma1 A G 4: 103,182,214 (GRCm39) probably null Het
Or12e13 G T 2: 87,663,523 (GRCm39) G47* probably null Het
Or1e16 T A 11: 73,286,853 (GRCm39) probably benign Het
Or1j15 T G 2: 36,458,988 (GRCm39) F126C probably benign Het
Or6c206 A G 10: 129,097,184 (GRCm39) Y118C probably damaging Het
Or6c216 A G 10: 129,678,482 (GRCm39) V143A probably damaging Het
Os9 A G 10: 126,933,918 (GRCm39) S500P possibly damaging Het
Osbpl11 A T 16: 33,047,660 (GRCm39) N541I Het
Pcnx4 A G 12: 72,613,671 (GRCm39) I539V probably benign Het
Ppfia3 T A 7: 44,999,717 (GRCm39) probably null Het
Ppp1r3a T C 6: 14,722,098 (GRCm39) K275E probably benign Het
Pten A G 19: 32,769,972 (GRCm39) N63S probably benign Het
Rptor A G 11: 119,777,896 (GRCm39) N1020S probably benign Het
Sall2 C A 14: 52,550,673 (GRCm39) D841Y possibly damaging Het
Sbno1 T A 5: 124,519,762 (GRCm39) H1172L probably benign Het
Scaf4 A T 16: 90,027,054 (GRCm39) L921Q probably damaging Het
Sec22c C A 9: 121,524,750 (GRCm39) R11L probably damaging Het
Skint6 T A 4: 113,034,173 (GRCm39) D318V probably damaging Het
Slc22a28 T C 19: 8,049,205 (GRCm39) N348S probably benign Het
Slc44a2 G T 9: 21,253,305 (GRCm39) K77N possibly damaging Het
Smc1b C T 15: 84,950,431 (GRCm39) V1198I probably benign Het
Spef2 A T 15: 9,717,568 (GRCm39) M316K probably damaging Het
Stra8 T C 6: 34,911,016 (GRCm39) Y215H probably damaging Het
Sv2a G T 3: 96,097,010 (GRCm39) R445L probably benign Het
Sycp1 A C 3: 102,758,944 (GRCm39) L771R probably damaging Het
Tchp A T 5: 114,859,184 (GRCm39) R493* probably null Het
Ttc13 G A 8: 125,410,039 (GRCm39) A391V probably benign Het
Unc13b C T 4: 43,176,186 (GRCm39) T2338I unknown Het
Wac A G 18: 7,921,592 (GRCm39) D576G probably damaging Het
Xdh T C 17: 74,222,688 (GRCm39) N559S probably benign Het
Zscan20 A T 4: 128,481,914 (GRCm39) S583T probably benign Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 127,734,498 (GRCm39) missense probably damaging 1.00
IGL00325:Itgax APN 7 127,747,481 (GRCm39) missense possibly damaging 0.69
IGL01155:Itgax APN 7 127,744,207 (GRCm39) missense probably benign 0.00
IGL01461:Itgax APN 7 127,734,190 (GRCm39) missense probably damaging 1.00
IGL01508:Itgax APN 7 127,743,990 (GRCm39) missense probably damaging 1.00
IGL01549:Itgax APN 7 127,730,378 (GRCm39) splice site probably null
IGL01864:Itgax APN 7 127,732,935 (GRCm39) missense probably benign 0.00
IGL02094:Itgax APN 7 127,730,645 (GRCm39) missense probably damaging 1.00
IGL02364:Itgax APN 7 127,739,154 (GRCm39) missense possibly damaging 0.89
IGL02969:Itgax APN 7 127,748,295 (GRCm39) missense probably benign
IGL03406:Itgax APN 7 127,748,370 (GRCm39) missense possibly damaging 0.93
Adendritic UTSW 7 127,747,744 (GRCm39) nonsense probably null
PIT4651001:Itgax UTSW 7 127,748,282 (GRCm39) missense probably benign 0.11
R0366:Itgax UTSW 7 127,748,261 (GRCm39) splice site probably benign
R0763:Itgax UTSW 7 127,747,112 (GRCm39) splice site probably benign
R1072:Itgax UTSW 7 127,749,316 (GRCm39) missense probably damaging 0.96
R1659:Itgax UTSW 7 127,730,063 (GRCm39) missense probably benign 0.15
R2019:Itgax UTSW 7 127,747,698 (GRCm39) missense probably benign
R2418:Itgax UTSW 7 127,741,505 (GRCm39) missense probably damaging 0.98
R3027:Itgax UTSW 7 127,747,744 (GRCm39) nonsense probably null
R3846:Itgax UTSW 7 127,732,939 (GRCm39) missense probably damaging 1.00
R3938:Itgax UTSW 7 127,735,445 (GRCm39) missense possibly damaging 0.73
R4021:Itgax UTSW 7 127,732,311 (GRCm39) critical splice donor site probably null
R4027:Itgax UTSW 7 127,740,438 (GRCm39) missense possibly damaging 0.75
R4163:Itgax UTSW 7 127,743,872 (GRCm39) missense probably benign 0.00
R4923:Itgax UTSW 7 127,747,700 (GRCm39) missense probably benign
R5259:Itgax UTSW 7 127,747,450 (GRCm39) missense probably damaging 0.99
R5333:Itgax UTSW 7 127,741,455 (GRCm39) missense probably damaging 1.00
R5347:Itgax UTSW 7 127,740,474 (GRCm39) missense probably benign 0.08
R5679:Itgax UTSW 7 127,734,162 (GRCm39) missense probably benign 0.00
R5725:Itgax UTSW 7 127,747,033 (GRCm39) missense possibly damaging 0.63
R5733:Itgax UTSW 7 127,739,647 (GRCm39) missense probably damaging 0.99
R5750:Itgax UTSW 7 127,743,878 (GRCm39) missense probably benign 0.32
R5964:Itgax UTSW 7 127,739,619 (GRCm39) missense probably damaging 1.00
R6004:Itgax UTSW 7 127,730,624 (GRCm39) missense probably damaging 0.96
R6168:Itgax UTSW 7 127,732,269 (GRCm39) missense probably damaging 0.99
R6212:Itgax UTSW 7 127,747,025 (GRCm39) missense probably benign 0.16
R6212:Itgax UTSW 7 127,729,504 (GRCm39) missense possibly damaging 0.52
R6480:Itgax UTSW 7 127,747,771 (GRCm39) missense probably benign 0.12
R6484:Itgax UTSW 7 127,732,890 (GRCm39) missense probably benign 0.13
R6796:Itgax UTSW 7 127,734,236 (GRCm39) missense probably damaging 1.00
R6844:Itgax UTSW 7 127,747,106 (GRCm39) splice site probably null
R7287:Itgax UTSW 7 127,747,677 (GRCm39) missense probably damaging 1.00
R7365:Itgax UTSW 7 127,734,481 (GRCm39) missense probably damaging 1.00
R7421:Itgax UTSW 7 127,739,604 (GRCm39) missense probably damaging 1.00
R7599:Itgax UTSW 7 127,747,262 (GRCm39) missense probably damaging 0.99
R7710:Itgax UTSW 7 127,735,028 (GRCm39) missense probably benign 0.04
R7964:Itgax UTSW 7 127,739,590 (GRCm39) critical splice acceptor site probably null
R8220:Itgax UTSW 7 127,730,090 (GRCm39) missense probably benign 0.00
R8730:Itgax UTSW 7 127,739,066 (GRCm39) critical splice acceptor site probably null
R8742:Itgax UTSW 7 127,743,795 (GRCm39) missense probably benign 0.28
R8812:Itgax UTSW 7 127,732,979 (GRCm39) missense probably damaging 1.00
R8871:Itgax UTSW 7 127,735,223 (GRCm39) missense probably damaging 1.00
R9147:Itgax UTSW 7 127,747,913 (GRCm39) missense possibly damaging 0.74
R9310:Itgax UTSW 7 127,741,432 (GRCm39) nonsense probably null
R9376:Itgax UTSW 7 127,747,935 (GRCm39) missense possibly damaging 0.94
R9377:Itgax UTSW 7 127,732,849 (GRCm39) missense probably benign 0.03
R9641:Itgax UTSW 7 127,741,152 (GRCm39) missense probably damaging 1.00
R9650:Itgax UTSW 7 127,734,935 (GRCm39) missense probably benign 0.24
R9709:Itgax UTSW 7 127,735,500 (GRCm39) missense probably damaging 1.00
X0061:Itgax UTSW 7 127,728,779 (GRCm39) start gained probably benign
Z1176:Itgax UTSW 7 127,744,044 (GRCm39) missense probably benign 0.24
Z1177:Itgax UTSW 7 127,747,234 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGAACATATCCCTGGGCCTG -3'
(R):5'- AGGATCTCTCCAGCTGTACC -3'

Sequencing Primer
(F):5'- AACCCTTCCTGGCTGTTGGTG -3'
(R):5'- GTACCGTCTGGCAATATATTTTCCAG -3'
Posted On 2022-01-20