Incidental Mutation 'R0766:Itih2'
List |< first << previous [record 13 of 37] next >> last >|
ID69490
Institutional Source Beutler Lab
Gene Symbol Itih2
Ensembl Gene ENSMUSG00000037254
Gene Nameinter-alpha trypsin inhibitor, heavy chain 2
SynonymsItih-2, Intin2
MMRRC Submission 038946-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R0766 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location10094593-10131396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10097924 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 800 (T800S)
Ref Sequence ENSEMBL: ENSMUSP00000046530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042290]
Predicted Effect probably benign
Transcript: ENSMUST00000042290
AA Change: T800S

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000046530
Gene: ENSMUSG00000037254
AA Change: T800S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VIT 60 189 4.35e-77 SMART
VWA 312 498 6.6e-32 SMART
Pfam:ITI_HC_C 740 925 1.7e-75 PFAM
Meta Mutation Damage Score 0.1653 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The inter-alpha-trypsin inhibitors (ITI) are a family of structurally related plasma serine protease inhibitors involved in extracellular matrix stabilization and in prevention of tumor metastasis. The ITI family contains multiple proteins made up of a light chain (see MIM 176870) and a variable number of heavy chains (Salier et al., 1987 [PubMed 2446322]; Himmelfarb et al., 2004 [PubMed 14744536]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A T 4: 103,270,797 F44I probably damaging Het
A2m T C 6: 121,676,890 probably benign Het
Card14 T C 11: 119,324,176 S241P probably damaging Het
Cdh15 G A 8: 122,861,449 probably benign Het
Dnah5 A C 15: 28,448,487 K4232T probably null Het
Eml6 A G 11: 29,831,219 probably benign Het
Esd T C 14: 74,742,121 S122P probably damaging Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Herc1 C T 9: 66,504,840 P4781S probably damaging Het
Iqch G A 9: 63,482,683 S738L probably benign Het
Itpr1 A G 6: 108,410,900 E1533G probably damaging Het
Klrg1 T C 6: 122,279,663 M55V probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Otos A C 1: 92,645,351 L14R probably damaging Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rel G A 11: 23,757,010 T64I probably damaging Het
Snai2 T A 16: 14,708,247 M254K possibly damaging Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tex22 A G 12: 113,088,523 N67S possibly damaging Het
Trank1 T G 9: 111,347,469 S270A probably benign Het
Ttc30a2 A T 2: 75,976,332 V612D probably benign Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r167 A G 7: 23,505,123 F156S probably benign Het
Vrk2 G A 11: 26,535,522 probably benign Het
Wdfy4 T C 14: 33,140,612 E601G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp638 A G 6: 83,929,041 N63D probably damaging Het
Other mutations in Itih2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01641:Itih2 APN 2 10110439 missense probably benign 0.00
IGL01775:Itih2 APN 2 10129286 missense probably benign 0.19
IGL02516:Itih2 APN 2 10097917 missense probably benign 0.00
IGL02698:Itih2 APN 2 10130501 missense probably damaging 1.00
IGL02747:Itih2 APN 2 10097945 missense probably benign 0.35
IGL03162:Itih2 APN 2 10126244 missense probably damaging 1.00
IGL03325:Itih2 APN 2 10106735 missense probably damaging 1.00
R0226:Itih2 UTSW 2 10115299 missense possibly damaging 0.71
R0316:Itih2 UTSW 2 10105246 missense possibly damaging 0.67
R0415:Itih2 UTSW 2 10105615 unclassified probably benign
R0612:Itih2 UTSW 2 10117394 missense probably benign 0.16
R0625:Itih2 UTSW 2 10123414 missense possibly damaging 0.49
R1312:Itih2 UTSW 2 10097924 missense probably benign 0.21
R1322:Itih2 UTSW 2 10109522 missense probably damaging 1.00
R1521:Itih2 UTSW 2 10106747 missense probably damaging 1.00
R1544:Itih2 UTSW 2 10105214 missense probably benign 0.27
R1622:Itih2 UTSW 2 10102079 missense probably benign 0.00
R1649:Itih2 UTSW 2 10105735 missense probably benign 0.37
R2064:Itih2 UTSW 2 10130574 missense possibly damaging 0.83
R2378:Itih2 UTSW 2 10094887 missense probably damaging 1.00
R2893:Itih2 UTSW 2 10102197 missense possibly damaging 0.79
R3732:Itih2 UTSW 2 10105670 missense probably benign 0.00
R3732:Itih2 UTSW 2 10105670 missense probably benign 0.00
R3733:Itih2 UTSW 2 10105670 missense probably benign 0.00
R4195:Itih2 UTSW 2 10115285 missense probably damaging 1.00
R4405:Itih2 UTSW 2 10106737 nonsense probably null
R4585:Itih2 UTSW 2 10110400 missense probably benign 0.00
R4586:Itih2 UTSW 2 10110400 missense probably benign 0.00
R4610:Itih2 UTSW 2 10105160 missense probably damaging 0.96
R5311:Itih2 UTSW 2 10110535 missense probably benign 0.01
R5361:Itih2 UTSW 2 10096461 missense probably benign 0.09
R5436:Itih2 UTSW 2 10105196 missense probably benign 0.00
R5454:Itih2 UTSW 2 10097993 missense probably null 0.00
R5580:Itih2 UTSW 2 10123476 missense probably damaging 1.00
R5621:Itih2 UTSW 2 10102805 missense probably benign 0.00
R5846:Itih2 UTSW 2 10097903 missense probably benign 0.00
R6083:Itih2 UTSW 2 10108894 intron probably benign
R6190:Itih2 UTSW 2 10098507 missense probably benign 0.37
R6198:Itih2 UTSW 2 10098541 missense probably benign 0.00
R6469:Itih2 UTSW 2 10123413 missense possibly damaging 0.65
R6816:Itih2 UTSW 2 10105706 missense probably damaging 1.00
R6820:Itih2 UTSW 2 10098098 missense probably benign 0.00
R6853:Itih2 UTSW 2 10115266 missense probably damaging 1.00
R7102:Itih2 UTSW 2 10105763 missense probably benign 0.27
R7173:Itih2 UTSW 2 10105163 missense probably damaging 1.00
R7387:Itih2 UTSW 2 10130508 missense possibly damaging 0.63
R8021:Itih2 UTSW 2 10105652 missense probably benign
R8065:Itih2 UTSW 2 10123483 missense probably damaging 0.99
R8067:Itih2 UTSW 2 10123483 missense probably damaging 0.99
R8110:Itih2 UTSW 2 10097137 missense probably damaging 0.98
RF012:Itih2 UTSW 2 10117403 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GTAGTCAGCTCCAGATCCCAATGC -3'
(R):5'- TAGTCAACGGTCAGCTTATCGGCG -3'

Sequencing Primer
(F):5'- TGAGCCTTGTCAGTGAGACAC -3'
(R):5'- GCGCCAAGAGGGCAGAG -3'
Posted On2013-09-30