Incidental Mutation 'R9149:Olfr812'
ID 694911
Institutional Source Beutler Lab
Gene Symbol Olfr812
Ensembl Gene ENSMUSG00000049052
Gene Name olfactory receptor 812
Synonyms GA_x6K02T2PULF-11521598-11520666, MOR110-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R9149 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 129841418-129846094 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129842613 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 143 (V143A)
Ref Sequence ENSEMBL: ENSMUSP00000145284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057775] [ENSMUST00000203571] [ENSMUST00000205013]
AlphaFold Q8VG64
Predicted Effect probably damaging
Transcript: ENSMUST00000057775
AA Change: V143A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053359
Gene: ENSMUSG00000049052
AA Change: V143A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-50 PFAM
Pfam:7tm_1 39 288 9.5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203571
AA Change: V143A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145284
Gene: ENSMUSG00000049052
AA Change: V143A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-50 PFAM
Pfam:7tm_1 39 288 9.5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205013
AA Change: V143A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145482
Gene: ENSMUSG00000049052
AA Change: V143A

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 1.3e-44 PFAM
Pfam:7tm_1 39 288 4.1e-23 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,446,304 S103N probably benign Het
Ace A G 11: 105,972,473 D358G possibly damaging Het
Acvr2b A T 9: 119,428,050 H115L probably damaging Het
Adam15 G A 3: 89,347,435 T106I possibly damaging Het
Adamts16 A G 13: 70,735,829 C1076R probably damaging Het
Adcy5 A G 16: 35,272,111 Y614C probably damaging Het
Adhfe1 A T 1: 9,557,051 H225L probably benign Het
Aff3 A G 1: 38,181,316 I1171T probably damaging Het
Agps T A 2: 75,866,838 M334K probably damaging Het
Akr1e1 A G 13: 4,602,679 probably null Het
Als2cl G A 9: 110,889,123 V311M probably benign Het
Amdhd1 A T 10: 93,539,951 L7H probably damaging Het
Apba1 A T 19: 23,893,418 I205F probably damaging Het
Arhgap26 A T 18: 39,111,864 E187D possibly damaging Het
Ash1l A T 3: 89,007,223 H1720L probably benign Het
Atp9a T C 2: 168,734,068 probably benign Het
Bcl7c G A 7: 127,708,523 A2V probably damaging Het
Catsperg1 G C 7: 29,210,487 P72R probably benign Het
Ccdc103 G A 11: 102,884,096 G174R probably benign Het
Ccdc171 A T 4: 83,694,275 K976M probably damaging Het
Ceacam1 T C 7: 25,473,935 N276S possibly damaging Het
Cep152 T C 2: 125,619,883 N91S probably damaging Het
Cep152 T C 2: 125,621,207 E18G probably damaging Het
Cers3 T C 7: 66,743,694 L17P probably benign Het
Cpsf3 A G 12: 21,306,843 N489S possibly damaging Het
Cramp1l A G 17: 24,968,946 S1225P probably damaging Het
Dck G A 5: 88,765,307 G18R probably benign Het
Dnah5 A T 15: 28,387,768 E3124D probably benign Het
Eogt T G 6: 97,113,878 L433F probably damaging Het
Fam135b A G 15: 71,462,895 S817P Het
Fsip2 T C 2: 82,982,030 Y2898H possibly damaging Het
Fzr1 T C 10: 81,369,415 H249R probably benign Het
Gbp10 T G 5: 105,218,995 Q457P probably damaging Het
Gin1 G C 1: 97,783,094 L167F probably damaging Het
Gm14226 A T 2: 155,024,923 I267F probably damaging Het
Gmnc A G 16: 26,962,892 probably null Het
Hectd2 A T 19: 36,599,002 I311F probably damaging Het
Heg1 A G 16: 33,738,591 K1085E probably benign Het
Hmbs G A 9: 44,341,686 Q34* probably null Het
Hyal6 T A 6: 24,734,152 M28K probably benign Het
Ifi27 T C 12: 103,439,419 V141A possibly damaging Het
Ift122 T A 6: 115,890,531 I414N probably damaging Het
Iglv2 A T 16: 19,260,684 V23E probably damaging Het
Itgax A T 7: 128,131,469 I120L probably benign Het
Kifc3 A G 8: 95,126,689 I13T probably benign Het
Lmod3 T C 6: 97,247,664 N399D probably damaging Het
Macf1 A T 4: 123,471,533 I3145K probably benign Het
Map2k5 A C 9: 63,293,724 I209S probably damaging Het
Mbd5 A G 2: 49,251,376 E117G probably damaging Het
Milr1 A G 11: 106,761,279 H172R probably benign Het
Myod1 A C 7: 46,377,169 D166A Het
Neb C T 2: 52,210,866 V4647M possibly damaging Het
Nek1 A T 8: 61,121,021 D1101V probably damaging Het
Nlrp2 A T 7: 5,327,573 V608D probably benign Het
Noc3l G A 19: 38,812,391 Q216* probably null Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nup160 T A 2: 90,722,241 probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Oat C T 7: 132,564,277 S193N probably benign Het
Olfr1 T A 11: 73,396,027 probably benign Het
Olfr1148 G T 2: 87,833,179 G47* probably null Het
Olfr344 T G 2: 36,568,976 F126C probably benign Het
Olfr776 A G 10: 129,261,315 Y118C probably damaging Het
Oma1 A G 4: 103,325,017 probably null Het
Os9 A G 10: 127,098,049 S500P possibly damaging Het
Osbpl11 A T 16: 33,227,290 N541I Het
Pcnx4 A G 12: 72,566,897 I539V probably benign Het
Ppfia3 T A 7: 45,350,293 probably null Het
Ppp1r3a T C 6: 14,722,099 K275E probably benign Het
Pten A G 19: 32,792,572 N63S probably benign Het
Rptor A G 11: 119,887,070 N1020S probably benign Het
Sall2 C A 14: 52,313,216 D841Y possibly damaging Het
Sbno1 T A 5: 124,381,699 H1172L probably benign Het
Scaf4 A T 16: 90,230,166 L921Q probably damaging Het
Sec22c C A 9: 121,695,684 R11L probably damaging Het
Skint6 T A 4: 113,176,976 D318V probably damaging Het
Slc22a28 T C 19: 8,071,840 N348S probably benign Het
Slc44a2 G T 9: 21,342,009 K77N possibly damaging Het
Smc1b C T 15: 85,066,230 V1198I probably benign Het
Spef2 A T 15: 9,717,482 M316K probably damaging Het
Stra8 T C 6: 34,934,081 Y215H probably damaging Het
Sv2a G T 3: 96,189,694 R445L probably benign Het
Sycp1 A C 3: 102,851,628 L771R probably damaging Het
Tchp A T 5: 114,721,123 R493* probably null Het
Ttc13 G A 8: 124,683,300 A391V probably benign Het
Unc13b C T 4: 43,176,186 T2338I unknown Het
Wac A G 18: 7,921,592 D576G probably damaging Het
Wdr34 T A 2: 30,033,941 T191S probably benign Het
Xdh T C 17: 73,915,693 N559S probably benign Het
Zscan20 A T 4: 128,588,121 S583T probably benign Het
Other mutations in Olfr812
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Olfr812 APN 10 129842473 missense probably damaging 1.00
IGL01637:Olfr812 APN 10 129842610 missense probably benign 0.14
IGL02035:Olfr812 APN 10 129842790 missense possibly damaging 0.95
IGL02546:Olfr812 APN 10 129842547 missense probably damaging 0.97
R1902:Olfr812 UTSW 10 129842506 missense probably benign
R4583:Olfr812 UTSW 10 129842475 missense probably damaging 1.00
R4598:Olfr812 UTSW 10 129842995 missense possibly damaging 0.92
R4714:Olfr812 UTSW 10 129842945 missense probably damaging 0.99
R5196:Olfr812 UTSW 10 129842781 missense possibly damaging 0.90
R5953:Olfr812 UTSW 10 129842614 missense probably benign 0.22
R6311:Olfr812 UTSW 10 129842907 missense possibly damaging 0.88
R6356:Olfr812 UTSW 10 129842608 missense probably benign 0.14
R6499:Olfr812 UTSW 10 129842584 missense probably benign 0.00
R9606:Olfr812 UTSW 10 129842756 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTGCTGAGCTGAAGGGAAC -3'
(R):5'- ATTCCCAGGTTCCTGATAAGC -3'

Sequencing Primer
(F):5'- AACTTTAGGATGGTTTTGATGATGAG -3'
(R):5'- CCTGATAAGCATTCTCTCAGGAG -3'
Posted On 2022-01-20