Incidental Mutation 'R9149:Rptor'
ID 694917
Institutional Source Beutler Lab
Gene Symbol Rptor
Ensembl Gene ENSMUSG00000025583
Gene Name regulatory associated protein of MTOR, complex 1
Synonyms Rap, raptor, 4932417H02Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9149 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 119493731-119790402 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119777896 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1020 (N1020S)
Ref Sequence ENSEMBL: ENSMUSP00000026671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000131217] [ENSMUST00000147781]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000026671
AA Change: N1020S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: N1020S

DomainStartEndE-ValueType
Raptor_N 54 207 2.3e-98 SMART
Pfam:HEAT_2 559 668 7.9e-11 PFAM
Pfam:HEAT 602 630 1.9e-6 PFAM
low complexity region 755 772 N/A INTRINSIC
low complexity region 877 887 N/A INTRINSIC
low complexity region 939 945 N/A INTRINSIC
WD40 1012 1050 2.56e1 SMART
WD40 1052 1097 4.28e0 SMART
WD40 1105 1151 1.83e2 SMART
WD40 1154 1194 1.82e-2 SMART
WD40 1200 1240 5.35e-1 SMART
WD40 1246 1281 7.13e0 SMART
WD40 1283 1329 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131217
SMART Domains Protein: ENSMUSP00000125667
Gene: ENSMUSG00000025583

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136662
SMART Domains Protein: ENSMUSP00000125293
Gene: ENSMUSG00000025583

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 172 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147781
SMART Domains Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583

DomainStartEndE-ValueType
Raptor_N 54 207 2.3e-98 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,396,304 (GRCm39) S103N probably benign Het
Ace A G 11: 105,863,299 (GRCm39) D358G possibly damaging Het
Acvr2b A T 9: 119,257,116 (GRCm39) H115L probably damaging Het
Adam15 G A 3: 89,254,742 (GRCm39) T106I possibly damaging Het
Adamts16 A G 13: 70,883,948 (GRCm39) C1076R probably damaging Het
Adcy5 A G 16: 35,092,481 (GRCm39) Y614C probably damaging Het
Adhfe1 A T 1: 9,627,276 (GRCm39) H225L probably benign Het
Aff3 A G 1: 38,220,397 (GRCm39) I1171T probably damaging Het
Agps T A 2: 75,697,182 (GRCm39) M334K probably damaging Het
Akr1e1 A G 13: 4,652,678 (GRCm39) probably null Het
Als2cl G A 9: 110,718,191 (GRCm39) V311M probably benign Het
Amdhd1 A T 10: 93,375,813 (GRCm39) L7H probably damaging Het
Apba1 A T 19: 23,870,782 (GRCm39) I205F probably damaging Het
Arhgap26 A T 18: 39,244,917 (GRCm39) E187D possibly damaging Het
Ash1l A T 3: 88,914,530 (GRCm39) H1720L probably benign Het
Atp9a T C 2: 168,575,988 (GRCm39) probably benign Het
Bcl7c G A 7: 127,307,695 (GRCm39) A2V probably damaging Het
Catsperg1 G C 7: 28,909,912 (GRCm39) P72R probably benign Het
Ccdc103 G A 11: 102,774,922 (GRCm39) G174R probably benign Het
Ccdc171 A T 4: 83,612,512 (GRCm39) K976M probably damaging Het
Ceacam1 T C 7: 25,173,360 (GRCm39) N276S possibly damaging Het
Cep152 T C 2: 125,463,127 (GRCm39) E18G probably damaging Het
Cep152 T C 2: 125,461,803 (GRCm39) N91S probably damaging Het
Cers3 T C 7: 66,393,442 (GRCm39) L17P probably benign Het
Cpsf3 A G 12: 21,356,844 (GRCm39) N489S possibly damaging Het
Cramp1 A G 17: 25,187,920 (GRCm39) S1225P probably damaging Het
Dck G A 5: 88,913,166 (GRCm39) G18R probably benign Het
Dnah5 A T 15: 28,387,914 (GRCm39) E3124D probably benign Het
Dync2i2 T A 2: 29,923,953 (GRCm39) T191S probably benign Het
Eogt T G 6: 97,090,839 (GRCm39) L433F probably damaging Het
Fam135b A G 15: 71,334,744 (GRCm39) S817P Het
Fsip2 T C 2: 82,812,374 (GRCm39) Y2898H possibly damaging Het
Fzr1 T C 10: 81,205,249 (GRCm39) H249R probably benign Het
Gbp10 T G 5: 105,366,861 (GRCm39) Q457P probably damaging Het
Gin1 G C 1: 97,710,819 (GRCm39) L167F probably damaging Het
Gm14226 A T 2: 154,866,843 (GRCm39) I267F probably damaging Het
Gmnc A G 16: 26,781,642 (GRCm39) probably null Het
Hectd2 A T 19: 36,576,402 (GRCm39) I311F probably damaging Het
Heg1 A G 16: 33,558,961 (GRCm39) K1085E probably benign Het
Hmbs G A 9: 44,252,983 (GRCm39) Q34* probably null Het
Hyal6 T A 6: 24,734,151 (GRCm39) M28K probably benign Het
Ifi27l2a T C 12: 103,405,678 (GRCm39) V141A possibly damaging Het
Ift122 T A 6: 115,867,492 (GRCm39) I414N probably damaging Het
Iglv2 A T 16: 19,079,434 (GRCm39) V23E probably damaging Het
Itgax A T 7: 127,730,641 (GRCm39) I120L probably benign Het
Kifc3 A G 8: 95,853,317 (GRCm39) I13T probably benign Het
Lmod3 T C 6: 97,224,625 (GRCm39) N399D probably damaging Het
Macf1 A T 4: 123,365,326 (GRCm39) I3145K probably benign Het
Map2k5 A C 9: 63,201,006 (GRCm39) I209S probably damaging Het
Mbd5 A G 2: 49,141,388 (GRCm39) E117G probably damaging Het
Milr1 A G 11: 106,652,105 (GRCm39) H172R probably benign Het
Myod1 A C 7: 46,026,593 (GRCm39) D166A Het
Neb C T 2: 52,100,878 (GRCm39) V4647M possibly damaging Het
Nek1 A T 8: 61,574,055 (GRCm39) D1101V probably damaging Het
Nlrp2 A T 7: 5,330,572 (GRCm39) V608D probably benign Het
Noc3l G A 19: 38,800,835 (GRCm39) Q216* probably null Het
Nos1 G C 5: 118,017,402 (GRCm39) R255P probably benign Het
Nup160 T A 2: 90,552,585 (GRCm39) probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Oat C T 7: 132,166,006 (GRCm39) S193N probably benign Het
Oma1 A G 4: 103,182,214 (GRCm39) probably null Het
Or12e13 G T 2: 87,663,523 (GRCm39) G47* probably null Het
Or1e16 T A 11: 73,286,853 (GRCm39) probably benign Het
Or1j15 T G 2: 36,458,988 (GRCm39) F126C probably benign Het
Or6c206 A G 10: 129,097,184 (GRCm39) Y118C probably damaging Het
Or6c216 A G 10: 129,678,482 (GRCm39) V143A probably damaging Het
Os9 A G 10: 126,933,918 (GRCm39) S500P possibly damaging Het
Osbpl11 A T 16: 33,047,660 (GRCm39) N541I Het
Pcnx4 A G 12: 72,613,671 (GRCm39) I539V probably benign Het
Ppfia3 T A 7: 44,999,717 (GRCm39) probably null Het
Ppp1r3a T C 6: 14,722,098 (GRCm39) K275E probably benign Het
Pten A G 19: 32,769,972 (GRCm39) N63S probably benign Het
Sall2 C A 14: 52,550,673 (GRCm39) D841Y possibly damaging Het
Sbno1 T A 5: 124,519,762 (GRCm39) H1172L probably benign Het
Scaf4 A T 16: 90,027,054 (GRCm39) L921Q probably damaging Het
Sec22c C A 9: 121,524,750 (GRCm39) R11L probably damaging Het
Skint6 T A 4: 113,034,173 (GRCm39) D318V probably damaging Het
Slc22a28 T C 19: 8,049,205 (GRCm39) N348S probably benign Het
Slc44a2 G T 9: 21,253,305 (GRCm39) K77N possibly damaging Het
Smc1b C T 15: 84,950,431 (GRCm39) V1198I probably benign Het
Spef2 A T 15: 9,717,568 (GRCm39) M316K probably damaging Het
Stra8 T C 6: 34,911,016 (GRCm39) Y215H probably damaging Het
Sv2a G T 3: 96,097,010 (GRCm39) R445L probably benign Het
Sycp1 A C 3: 102,758,944 (GRCm39) L771R probably damaging Het
Tchp A T 5: 114,859,184 (GRCm39) R493* probably null Het
Ttc13 G A 8: 125,410,039 (GRCm39) A391V probably benign Het
Unc13b C T 4: 43,176,186 (GRCm39) T2338I unknown Het
Wac A G 18: 7,921,592 (GRCm39) D576G probably damaging Het
Xdh T C 17: 74,222,688 (GRCm39) N559S probably benign Het
Zscan20 A T 4: 128,481,914 (GRCm39) S583T probably benign Het
Other mutations in Rptor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Rptor APN 11 119,690,271 (GRCm39) missense possibly damaging 0.92
IGL01319:Rptor APN 11 119,781,996 (GRCm39) missense probably benign 0.01
IGL01375:Rptor APN 11 119,787,262 (GRCm39) missense possibly damaging 0.68
IGL01899:Rptor APN 11 119,748,279 (GRCm39) missense probably benign 0.04
IGL01927:Rptor APN 11 119,548,500 (GRCm39) missense probably damaging 1.00
IGL02312:Rptor APN 11 119,737,741 (GRCm39) missense possibly damaging 0.84
IGL02620:Rptor APN 11 119,671,413 (GRCm39) missense probably benign 0.12
IGL02651:Rptor APN 11 119,783,438 (GRCm39) missense possibly damaging 0.69
IGL03182:Rptor APN 11 119,615,971 (GRCm39) missense probably damaging 1.00
Velocipede UTSW 11 119,786,803 (GRCm39) missense possibly damaging 0.92
R0103:Rptor UTSW 11 119,775,793 (GRCm39) missense probably benign 0.01
R0179:Rptor UTSW 11 119,763,193 (GRCm39) missense probably benign 0.14
R0217:Rptor UTSW 11 119,785,738 (GRCm39) splice site probably benign
R0219:Rptor UTSW 11 119,712,603 (GRCm39) intron probably benign
R0324:Rptor UTSW 11 119,783,467 (GRCm39) missense probably damaging 1.00
R0432:Rptor UTSW 11 119,671,379 (GRCm39) nonsense probably null
R0718:Rptor UTSW 11 119,763,202 (GRCm39) missense probably benign 0.15
R0730:Rptor UTSW 11 119,775,780 (GRCm39) missense probably benign 0.06
R1019:Rptor UTSW 11 119,734,569 (GRCm39) missense probably damaging 1.00
R1073:Rptor UTSW 11 119,634,717 (GRCm39) missense possibly damaging 0.93
R1424:Rptor UTSW 11 119,671,419 (GRCm39) nonsense probably null
R1579:Rptor UTSW 11 119,786,827 (GRCm39) missense probably benign 0.00
R1766:Rptor UTSW 11 119,615,887 (GRCm39) missense probably damaging 0.99
R1844:Rptor UTSW 11 119,647,146 (GRCm39) missense probably damaging 1.00
R2180:Rptor UTSW 11 119,615,970 (GRCm39) missense probably damaging 1.00
R2274:Rptor UTSW 11 119,647,148 (GRCm39) nonsense probably null
R2275:Rptor UTSW 11 119,647,148 (GRCm39) nonsense probably null
R2408:Rptor UTSW 11 119,748,277 (GRCm39) missense probably damaging 0.99
R2981:Rptor UTSW 11 119,756,420 (GRCm39) missense probably damaging 1.00
R2996:Rptor UTSW 11 119,747,124 (GRCm39) missense probably damaging 1.00
R3001:Rptor UTSW 11 119,763,197 (GRCm39) missense possibly damaging 0.94
R3002:Rptor UTSW 11 119,763,197 (GRCm39) missense possibly damaging 0.94
R3003:Rptor UTSW 11 119,763,197 (GRCm39) missense possibly damaging 0.94
R4358:Rptor UTSW 11 119,562,171 (GRCm39) missense probably damaging 0.98
R4592:Rptor UTSW 11 119,689,666 (GRCm39) missense probably null 1.00
R4647:Rptor UTSW 11 119,781,989 (GRCm39) missense probably benign 0.33
R4666:Rptor UTSW 11 119,634,708 (GRCm39) missense probably damaging 1.00
R4958:Rptor UTSW 11 119,748,217 (GRCm39) missense probably benign 0.29
R4974:Rptor UTSW 11 119,712,466 (GRCm39) intron probably benign
R5073:Rptor UTSW 11 119,787,305 (GRCm39) missense possibly damaging 0.71
R5199:Rptor UTSW 11 119,494,642 (GRCm39) missense probably benign
R5216:Rptor UTSW 11 119,734,539 (GRCm39) missense probably damaging 0.98
R5219:Rptor UTSW 11 119,734,539 (GRCm39) missense probably damaging 0.98
R5277:Rptor UTSW 11 119,713,782 (GRCm39) missense probably damaging 1.00
R5365:Rptor UTSW 11 119,734,539 (GRCm39) missense probably damaging 0.98
R5366:Rptor UTSW 11 119,734,539 (GRCm39) missense probably damaging 0.98
R5447:Rptor UTSW 11 119,734,539 (GRCm39) missense probably damaging 0.98
R5630:Rptor UTSW 11 119,647,075 (GRCm39) missense probably benign 0.01
R6220:Rptor UTSW 11 119,788,268 (GRCm39) missense possibly damaging 0.83
R6567:Rptor UTSW 11 119,786,838 (GRCm39) missense probably benign 0.00
R6741:Rptor UTSW 11 119,786,803 (GRCm39) missense possibly damaging 0.92
R6915:Rptor UTSW 11 119,647,171 (GRCm39) missense probably damaging 0.99
R7032:Rptor UTSW 11 119,737,762 (GRCm39) missense probably benign 0.00
R7051:Rptor UTSW 11 119,765,012 (GRCm39) utr 3 prime probably benign
R7396:Rptor UTSW 11 119,763,181 (GRCm39) missense probably benign 0.10
R7429:Rptor UTSW 11 119,737,654 (GRCm39) missense probably damaging 1.00
R7430:Rptor UTSW 11 119,737,654 (GRCm39) missense probably damaging 1.00
R7447:Rptor UTSW 11 119,775,805 (GRCm39) missense probably benign 0.00
R7595:Rptor UTSW 11 119,634,779 (GRCm39) missense possibly damaging 0.82
R7776:Rptor UTSW 11 119,783,453 (GRCm39) missense probably benign 0.01
R7854:Rptor UTSW 11 119,748,779 (GRCm39) missense probably benign 0.02
R8288:Rptor UTSW 11 119,748,763 (GRCm39) missense probably benign 0.02
R8305:Rptor UTSW 11 119,702,812 (GRCm39) missense probably damaging 1.00
R8328:Rptor UTSW 11 119,783,473 (GRCm39) missense probably benign 0.00
R8351:Rptor UTSW 11 119,783,465 (GRCm39) missense probably benign 0.22
R8772:Rptor UTSW 11 119,615,858 (GRCm39) missense probably damaging 1.00
R8871:Rptor UTSW 11 119,494,751 (GRCm39) missense probably benign 0.01
R8925:Rptor UTSW 11 119,782,036 (GRCm39) missense probably benign 0.11
R8927:Rptor UTSW 11 119,782,036 (GRCm39) missense probably benign 0.11
R8981:Rptor UTSW 11 119,734,508 (GRCm39) missense possibly damaging 0.90
R9213:Rptor UTSW 11 119,494,765 (GRCm39) missense probably benign
R9224:Rptor UTSW 11 119,785,113 (GRCm39) missense probably benign 0.11
R9290:Rptor UTSW 11 119,702,823 (GRCm39) missense probably benign 0.00
R9314:Rptor UTSW 11 119,786,772 (GRCm39) missense probably benign 0.43
R9371:Rptor UTSW 11 119,562,152 (GRCm39) missense possibly damaging 0.66
R9719:Rptor UTSW 11 119,781,940 (GRCm39) missense probably benign 0.13
R9751:Rptor UTSW 11 119,777,964 (GRCm39) missense probably benign 0.02
X0050:Rptor UTSW 11 119,737,231 (GRCm39) missense probably benign 0.14
X0066:Rptor UTSW 11 119,748,692 (GRCm39) missense probably benign 0.31
Z0001:Rptor UTSW 11 119,762,318 (GRCm39) critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119,748,279 (GRCm39) critical splice donor site probably benign
Z0001:Rptor UTSW 11 119,742,294 (GRCm39) critical splice donor site probably benign
Z0001:Rptor UTSW 11 119,737,578 (GRCm39) critical splice acceptor site probably null
Z0001:Rptor UTSW 11 119,690,145 (GRCm39) critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119,647,241 (GRCm39) critical splice donor site probably benign
Z0001:Rptor UTSW 11 119,647,062 (GRCm39) splice site probably null
Z0001:Rptor UTSW 11 119,494,798 (GRCm39) critical splice donor site probably null
Z0001:Rptor UTSW 11 119,787,375 (GRCm39) critical splice donor site probably benign
Z0001:Rptor UTSW 11 119,764,977 (GRCm39) critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TGCCAGGAGTTGTAAGACG -3'
(R):5'- TTTACTAAGGAAGACCCGGTG -3'

Sequencing Primer
(F):5'- CATAGACCCTAGAGCTGTGGATGC -3'
(R):5'- ACCCGGTGAGTCCAGAATG -3'
Posted On 2022-01-20