Mutagenetix > Incidental Mutation

Incidental Mutation 'R9149:Rptor'

694917

Institutional Source

Beutler Lab

Gene Symbol

Rptor

Ensembl Gene

ENSMUSG00000025583

Gene Name

regulatory associated protein of MTOR, complex 1

Synonyms

raptor, Rap, 4932417H02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9149 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119602905-119899576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119887070 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1020 (N1020S)

Ref Sequence

ENSEMBL: ENSMUSP00000026671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000131217] [ENSMUST00000147781]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000026671
AA Change: N1020S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: N1020S

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART
Pfam:HEAT_2	559	668	7.9e-11	PFAM
Pfam:HEAT	602	630	1.9e-6	PFAM
low complexity region	755	772	N/A	INTRINSIC
low complexity region	877	887	N/A	INTRINSIC
low complexity region	939	945	N/A	INTRINSIC
WD40	1012	1050	2.56e1	SMART
WD40	1052	1097	4.28e0	SMART
WD40	1105	1151	1.83e2	SMART
WD40	1154	1194	1.82e-2	SMART
WD40	1200	1240	5.35e-1	SMART
WD40	1246	1281	7.13e0	SMART
WD40	1283	1329	2.67e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131217

SMART Domains

Protein: ENSMUSP00000125667
Gene: ENSMUSG00000025583

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136662

SMART Domains

Protein: ENSMUSP00000125293
Gene: ENSMUSG00000025583

Domain	Start	End	E-Value	Type
low complexity region	50	67	N/A	INTRINSIC
low complexity region	172	182	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147781

SMART Domains

Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (90/90)

MGI Phenotype

FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,446,304	S103N	probably benign	Het
Ace	A	G	11: 105,972,473	D358G	possibly damaging	Het
Acvr2b	A	T	9: 119,428,050	H115L	probably damaging	Het
Adam15	G	A	3: 89,347,435	T106I	possibly damaging	Het
Adamts16	A	G	13: 70,735,829	C1076R	probably damaging	Het
Adcy5	A	G	16: 35,272,111	Y614C	probably damaging	Het
Adhfe1	A	T	1: 9,557,051	H225L	probably benign	Het
Aff3	A	G	1: 38,181,316	I1171T	probably damaging	Het
Agps	T	A	2: 75,866,838	M334K	probably damaging	Het
Akr1e1	A	G	13: 4,602,679		probably null	Het
Als2cl	G	A	9: 110,889,123	V311M	probably benign	Het
Amdhd1	A	T	10: 93,539,951	L7H	probably damaging	Het
Apba1	A	T	19: 23,893,418	I205F	probably damaging	Het
Arhgap26	A	T	18: 39,111,864	E187D	possibly damaging	Het
Ash1l	A	T	3: 89,007,223	H1720L	probably benign	Het
Atp9a	T	C	2: 168,734,068		probably benign	Het
Bcl7c	G	A	7: 127,708,523	A2V	probably damaging	Het
Catsperg1	G	C	7: 29,210,487	P72R	probably benign	Het
Ccdc103	G	A	11: 102,884,096	G174R	probably benign	Het
Ccdc171	A	T	4: 83,694,275	K976M	probably damaging	Het
Ceacam1	T	C	7: 25,473,935	N276S	possibly damaging	Het
Cep152	T	C	2: 125,619,883	N91S	probably damaging	Het
Cep152	T	C	2: 125,621,207	E18G	probably damaging	Het
Cers3	T	C	7: 66,743,694	L17P	probably benign	Het
Cpsf3	A	G	12: 21,306,843	N489S	possibly damaging	Het
Cramp1l	A	G	17: 24,968,946	S1225P	probably damaging	Het
Dck	G	A	5: 88,765,307	G18R	probably benign	Het
Dnah5	A	T	15: 28,387,768	E3124D	probably benign	Het
Eogt	T	G	6: 97,113,878	L433F	probably damaging	Het
Fam135b	A	G	15: 71,462,895	S817P		Het
Fsip2	T	C	2: 82,982,030	Y2898H	possibly damaging	Het
Fzr1	T	C	10: 81,369,415	H249R	probably benign	Het
Gbp10	T	G	5: 105,218,995	Q457P	probably damaging	Het
Gin1	G	C	1: 97,783,094	L167F	probably damaging	Het
Gm14226	A	T	2: 155,024,923	I267F	probably damaging	Het
Gmnc	A	G	16: 26,962,892		probably null	Het
Hectd2	A	T	19: 36,599,002	I311F	probably damaging	Het
Heg1	A	G	16: 33,738,591	K1085E	probably benign	Het
Hmbs	G	A	9: 44,341,686	Q34*	probably null	Het
Hyal6	T	A	6: 24,734,152	M28K	probably benign	Het
Ifi27	T	C	12: 103,439,419	V141A	possibly damaging	Het
Ift122	T	A	6: 115,890,531	I414N	probably damaging	Het
Iglv2	A	T	16: 19,260,684	V23E	probably damaging	Het
Itgax	A	T	7: 128,131,469	I120L	probably benign	Het
Kifc3	A	G	8: 95,126,689	I13T	probably benign	Het
Lmod3	T	C	6: 97,247,664	N399D	probably damaging	Het
Macf1	A	T	4: 123,471,533	I3145K	probably benign	Het
Map2k5	A	C	9: 63,293,724	I209S	probably damaging	Het
Mbd5	A	G	2: 49,251,376	E117G	probably damaging	Het
Milr1	A	G	11: 106,761,279	H172R	probably benign	Het
Myod1	A	C	7: 46,377,169	D166A		Het
Neb	C	T	2: 52,210,866	V4647M	possibly damaging	Het
Nek1	A	T	8: 61,121,021	D1101V	probably damaging	Het
Nlrp2	A	T	7: 5,327,573	V608D	probably benign	Het
Noc3l	G	A	19: 38,812,391	Q216*	probably null	Het
Nos1	G	C	5: 117,879,337	R255P	probably benign	Het
Nup160	T	A	2: 90,722,241		probably benign	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Oat	C	T	7: 132,564,277	S193N	probably benign	Het
Olfr1	T	A	11: 73,396,027		probably benign	Het
Olfr1148	G	T	2: 87,833,179	G47*	probably null	Het
Olfr344	T	G	2: 36,568,976	F126C	probably benign	Het
Olfr776	A	G	10: 129,261,315	Y118C	probably damaging	Het
Olfr812	A	G	10: 129,842,613	V143A	probably damaging	Het
Oma1	A	G	4: 103,325,017		probably null	Het
Os9	A	G	10: 127,098,049	S500P	possibly damaging	Het
Osbpl11	A	T	16: 33,227,290	N541I		Het
Pcnx4	A	G	12: 72,566,897	I539V	probably benign	Het
Ppfia3	T	A	7: 45,350,293		probably null	Het
Ppp1r3a	T	C	6: 14,722,099	K275E	probably benign	Het
Pten	A	G	19: 32,792,572	N63S	probably benign	Het
Sall2	C	A	14: 52,313,216	D841Y	possibly damaging	Het
Sbno1	T	A	5: 124,381,699	H1172L	probably benign	Het
Scaf4	A	T	16: 90,230,166	L921Q	probably damaging	Het
Sec22c	C	A	9: 121,695,684	R11L	probably damaging	Het
Skint6	T	A	4: 113,176,976	D318V	probably damaging	Het
Slc22a28	T	C	19: 8,071,840	N348S	probably benign	Het
Slc44a2	G	T	9: 21,342,009	K77N	possibly damaging	Het
Smc1b	C	T	15: 85,066,230	V1198I	probably benign	Het
Spef2	A	T	15: 9,717,482	M316K	probably damaging	Het
Stra8	T	C	6: 34,934,081	Y215H	probably damaging	Het
Sv2a	G	T	3: 96,189,694	R445L	probably benign	Het
Sycp1	A	C	3: 102,851,628	L771R	probably damaging	Het
Tchp	A	T	5: 114,721,123	R493*	probably null	Het
Ttc13	G	A	8: 124,683,300	A391V	probably benign	Het
Unc13b	C	T	4: 43,176,186	T2338I	unknown	Het
Wac	A	G	18: 7,921,592	D576G	probably damaging	Het
Wdr34	T	A	2: 30,033,941	T191S	probably benign	Het
Xdh	T	C	17: 73,915,693	N559S	probably benign	Het
Zscan20	A	T	4: 128,588,121	S583T	probably benign	Het

Other mutations in Rptor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00537:Rptor	APN	11	119799445	missense	possibly damaging	0.92
IGL01319:Rptor	APN	11	119891170	missense	probably benign	0.01
IGL01375:Rptor	APN	11	119896436	missense	possibly damaging	0.68
IGL01899:Rptor	APN	11	119857453	missense	probably benign	0.04
IGL01927:Rptor	APN	11	119657674	missense	probably damaging	1.00
IGL02312:Rptor	APN	11	119846915	missense	possibly damaging	0.84
IGL02620:Rptor	APN	11	119780587	missense	probably benign	0.12
IGL02651:Rptor	APN	11	119892612	missense	possibly damaging	0.69
IGL03182:Rptor	APN	11	119725145	missense	probably damaging	1.00
Velocipede	UTSW	11	119895977	missense	possibly damaging	0.92
R0103:Rptor	UTSW	11	119884967	missense	probably benign	0.01
R0179:Rptor	UTSW	11	119872367	missense	probably benign	0.14
R0217:Rptor	UTSW	11	119894912	splice site	probably benign
R0219:Rptor	UTSW	11	119821777	intron	probably benign
R0324:Rptor	UTSW	11	119892641	missense	probably damaging	1.00
R0432:Rptor	UTSW	11	119780553	nonsense	probably null
R0718:Rptor	UTSW	11	119872376	missense	probably benign	0.15
R0730:Rptor	UTSW	11	119884954	missense	probably benign	0.06
R1019:Rptor	UTSW	11	119843743	missense	probably damaging	1.00
R1073:Rptor	UTSW	11	119743891	missense	possibly damaging	0.93
R1424:Rptor	UTSW	11	119780593	nonsense	probably null
R1579:Rptor	UTSW	11	119896001	missense	probably benign	0.00
R1766:Rptor	UTSW	11	119725061	missense	probably damaging	0.99
R1844:Rptor	UTSW	11	119756320	missense	probably damaging	1.00
R2180:Rptor	UTSW	11	119725144	missense	probably damaging	1.00
R2274:Rptor	UTSW	11	119756322	nonsense	probably null
R2275:Rptor	UTSW	11	119756322	nonsense	probably null
R2408:Rptor	UTSW	11	119857451	missense	probably damaging	0.99
R2981:Rptor	UTSW	11	119865594	missense	probably damaging	1.00
R2996:Rptor	UTSW	11	119856298	missense	probably damaging	1.00
R3001:Rptor	UTSW	11	119872371	missense	possibly damaging	0.94
R3002:Rptor	UTSW	11	119872371	missense	possibly damaging	0.94
R3003:Rptor	UTSW	11	119872371	missense	possibly damaging	0.94
R4358:Rptor	UTSW	11	119671345	missense	probably damaging	0.98
R4592:Rptor	UTSW	11	119798840	missense	probably null	1.00
R4647:Rptor	UTSW	11	119891163	missense	probably benign	0.33
R4666:Rptor	UTSW	11	119743882	missense	probably damaging	1.00
R4958:Rptor	UTSW	11	119857391	missense	probably benign	0.29
R4974:Rptor	UTSW	11	119821640	intron	probably benign
R5073:Rptor	UTSW	11	119896479	missense	possibly damaging	0.71
R5199:Rptor	UTSW	11	119603816	missense	probably benign
R5216:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5219:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5277:Rptor	UTSW	11	119822956	missense	probably damaging	1.00
R5365:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5366:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5447:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5630:Rptor	UTSW	11	119756249	missense	probably benign	0.01
R6220:Rptor	UTSW	11	119897442	missense	possibly damaging	0.83
R6567:Rptor	UTSW	11	119896012	missense	probably benign	0.00
R6741:Rptor	UTSW	11	119895977	missense	possibly damaging	0.92
R6915:Rptor	UTSW	11	119756345	missense	probably damaging	0.99
R7032:Rptor	UTSW	11	119846936	missense	probably benign	0.00
R7051:Rptor	UTSW	11	119874186	utr 3 prime	probably benign
R7396:Rptor	UTSW	11	119872355	missense	probably benign	0.10
R7429:Rptor	UTSW	11	119846828	missense	probably damaging	1.00
R7430:Rptor	UTSW	11	119846828	missense	probably damaging	1.00
R7447:Rptor	UTSW	11	119884979	missense	probably benign	0.00
R7595:Rptor	UTSW	11	119743953	missense	possibly damaging	0.82
R7776:Rptor	UTSW	11	119892627	missense	probably benign	0.01
R7854:Rptor	UTSW	11	119857953	missense	probably benign	0.02
R8288:Rptor	UTSW	11	119857937	missense	probably benign	0.02
R8305:Rptor	UTSW	11	119811986	missense	probably damaging	1.00
R8328:Rptor	UTSW	11	119892647	missense	probably benign	0.00
R8351:Rptor	UTSW	11	119892639	missense	probably benign	0.22
R8772:Rptor	UTSW	11	119725032	missense	probably damaging	1.00
R8871:Rptor	UTSW	11	119603925	missense	probably benign	0.01
R8925:Rptor	UTSW	11	119891210	missense	probably benign	0.11
R8927:Rptor	UTSW	11	119891210	missense	probably benign	0.11
R8981:Rptor	UTSW	11	119843682	missense	possibly damaging	0.90
R9213:Rptor	UTSW	11	119603939	missense	probably benign
R9224:Rptor	UTSW	11	119894287	missense	probably benign	0.11
R9290:Rptor	UTSW	11	119811997	missense	probably benign	0.00
R9314:Rptor	UTSW	11	119895946	missense	probably benign	0.43
R9371:Rptor	UTSW	11	119671326	missense	possibly damaging	0.66
R9719:Rptor	UTSW	11	119891114	missense	probably benign	0.13
R9751:Rptor	UTSW	11	119887138	missense	probably benign	0.02
X0050:Rptor	UTSW	11	119846405	missense	probably benign	0.14
X0066:Rptor	UTSW	11	119857866	missense	probably benign	0.31
Z0001:Rptor	UTSW	11	119756236	splice site	probably null
Z0001:Rptor	UTSW	11	119874151	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119603972	critical splice donor site	probably null
Z0001:Rptor	UTSW	11	119871492	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119756415	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119896549	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119851468	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119846752	critical splice acceptor site	probably null
Z0001:Rptor	UTSW	11	119857453	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119799319	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCCAGGAGTTGTAAGACG -3'
(R):5'- TTTACTAAGGAAGACCCGGTG -3'

Sequencing Primer
(F):5'- CATAGACCCTAGAGCTGTGGATGC -3'
(R):5'- ACCCGGTGAGTCCAGAATG -3'

Posted On

2022-01-20