Incidental Mutation 'R9149:Sall2'
ID 694923
Institutional Source Beutler Lab
Gene Symbol Sall2
Ensembl Gene ENSMUSG00000049532
Gene Name spalt like transcription factor 2
Synonyms Msal-2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9149 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 52548634-52566127 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 52550673 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 841 (D841Y)
Ref Sequence ENSEMBL: ENSMUSP00000056401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]
AlphaFold Q9QX96
Predicted Effect possibly damaging
Transcript: ENSMUST00000058326
AA Change: D841Y

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: D841Y

DomainStartEndE-ValueType
low complexity region 71 81 N/A INTRINSIC
low complexity region 97 110 N/A INTRINSIC
low complexity region 128 139 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
ZnF_C2H2 372 394 2.57e-3 SMART
ZnF_C2H2 400 422 1.28e-3 SMART
low complexity region 476 501 N/A INTRINSIC
low complexity region 602 627 N/A INTRINSIC
ZnF_C2H2 629 651 1.2e1 SMART
ZnF_C2H2 657 679 1.69e-3 SMART
ZnF_C2H2 689 711 6.88e-4 SMART
low complexity region 719 730 N/A INTRINSIC
low complexity region 747 779 N/A INTRINSIC
low complexity region 799 819 N/A INTRINSIC
low complexity region 829 848 N/A INTRINSIC
ZnF_C2H2 908 930 2.09e-3 SMART
ZnF_C2H2 937 960 1.01e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135523
AA Change: D839Y

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,396,304 (GRCm39) S103N probably benign Het
Ace A G 11: 105,863,299 (GRCm39) D358G possibly damaging Het
Acvr2b A T 9: 119,257,116 (GRCm39) H115L probably damaging Het
Adam15 G A 3: 89,254,742 (GRCm39) T106I possibly damaging Het
Adamts16 A G 13: 70,883,948 (GRCm39) C1076R probably damaging Het
Adcy5 A G 16: 35,092,481 (GRCm39) Y614C probably damaging Het
Adhfe1 A T 1: 9,627,276 (GRCm39) H225L probably benign Het
Aff3 A G 1: 38,220,397 (GRCm39) I1171T probably damaging Het
Agps T A 2: 75,697,182 (GRCm39) M334K probably damaging Het
Akr1e1 A G 13: 4,652,678 (GRCm39) probably null Het
Als2cl G A 9: 110,718,191 (GRCm39) V311M probably benign Het
Amdhd1 A T 10: 93,375,813 (GRCm39) L7H probably damaging Het
Apba1 A T 19: 23,870,782 (GRCm39) I205F probably damaging Het
Arhgap26 A T 18: 39,244,917 (GRCm39) E187D possibly damaging Het
Ash1l A T 3: 88,914,530 (GRCm39) H1720L probably benign Het
Atp9a T C 2: 168,575,988 (GRCm39) probably benign Het
Bcl7c G A 7: 127,307,695 (GRCm39) A2V probably damaging Het
Catsperg1 G C 7: 28,909,912 (GRCm39) P72R probably benign Het
Ccdc103 G A 11: 102,774,922 (GRCm39) G174R probably benign Het
Ccdc171 A T 4: 83,612,512 (GRCm39) K976M probably damaging Het
Ceacam1 T C 7: 25,173,360 (GRCm39) N276S possibly damaging Het
Cep152 T C 2: 125,463,127 (GRCm39) E18G probably damaging Het
Cep152 T C 2: 125,461,803 (GRCm39) N91S probably damaging Het
Cers3 T C 7: 66,393,442 (GRCm39) L17P probably benign Het
Cpsf3 A G 12: 21,356,844 (GRCm39) N489S possibly damaging Het
Cramp1 A G 17: 25,187,920 (GRCm39) S1225P probably damaging Het
Dck G A 5: 88,913,166 (GRCm39) G18R probably benign Het
Dnah5 A T 15: 28,387,914 (GRCm39) E3124D probably benign Het
Dync2i2 T A 2: 29,923,953 (GRCm39) T191S probably benign Het
Eogt T G 6: 97,090,839 (GRCm39) L433F probably damaging Het
Fam135b A G 15: 71,334,744 (GRCm39) S817P Het
Fsip2 T C 2: 82,812,374 (GRCm39) Y2898H possibly damaging Het
Fzr1 T C 10: 81,205,249 (GRCm39) H249R probably benign Het
Gbp10 T G 5: 105,366,861 (GRCm39) Q457P probably damaging Het
Gin1 G C 1: 97,710,819 (GRCm39) L167F probably damaging Het
Gm14226 A T 2: 154,866,843 (GRCm39) I267F probably damaging Het
Gmnc A G 16: 26,781,642 (GRCm39) probably null Het
Hectd2 A T 19: 36,576,402 (GRCm39) I311F probably damaging Het
Heg1 A G 16: 33,558,961 (GRCm39) K1085E probably benign Het
Hmbs G A 9: 44,252,983 (GRCm39) Q34* probably null Het
Hyal6 T A 6: 24,734,151 (GRCm39) M28K probably benign Het
Ifi27l2a T C 12: 103,405,678 (GRCm39) V141A possibly damaging Het
Ift122 T A 6: 115,867,492 (GRCm39) I414N probably damaging Het
Iglv2 A T 16: 19,079,434 (GRCm39) V23E probably damaging Het
Itgax A T 7: 127,730,641 (GRCm39) I120L probably benign Het
Kifc3 A G 8: 95,853,317 (GRCm39) I13T probably benign Het
Lmod3 T C 6: 97,224,625 (GRCm39) N399D probably damaging Het
Macf1 A T 4: 123,365,326 (GRCm39) I3145K probably benign Het
Map2k5 A C 9: 63,201,006 (GRCm39) I209S probably damaging Het
Mbd5 A G 2: 49,141,388 (GRCm39) E117G probably damaging Het
Milr1 A G 11: 106,652,105 (GRCm39) H172R probably benign Het
Myod1 A C 7: 46,026,593 (GRCm39) D166A Het
Neb C T 2: 52,100,878 (GRCm39) V4647M possibly damaging Het
Nek1 A T 8: 61,574,055 (GRCm39) D1101V probably damaging Het
Nlrp2 A T 7: 5,330,572 (GRCm39) V608D probably benign Het
Noc3l G A 19: 38,800,835 (GRCm39) Q216* probably null Het
Nos1 G C 5: 118,017,402 (GRCm39) R255P probably benign Het
Nup160 T A 2: 90,552,585 (GRCm39) probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Oat C T 7: 132,166,006 (GRCm39) S193N probably benign Het
Oma1 A G 4: 103,182,214 (GRCm39) probably null Het
Or12e13 G T 2: 87,663,523 (GRCm39) G47* probably null Het
Or1e16 T A 11: 73,286,853 (GRCm39) probably benign Het
Or1j15 T G 2: 36,458,988 (GRCm39) F126C probably benign Het
Or6c206 A G 10: 129,097,184 (GRCm39) Y118C probably damaging Het
Or6c216 A G 10: 129,678,482 (GRCm39) V143A probably damaging Het
Os9 A G 10: 126,933,918 (GRCm39) S500P possibly damaging Het
Osbpl11 A T 16: 33,047,660 (GRCm39) N541I Het
Pcnx4 A G 12: 72,613,671 (GRCm39) I539V probably benign Het
Ppfia3 T A 7: 44,999,717 (GRCm39) probably null Het
Ppp1r3a T C 6: 14,722,098 (GRCm39) K275E probably benign Het
Pten A G 19: 32,769,972 (GRCm39) N63S probably benign Het
Rptor A G 11: 119,777,896 (GRCm39) N1020S probably benign Het
Sbno1 T A 5: 124,519,762 (GRCm39) H1172L probably benign Het
Scaf4 A T 16: 90,027,054 (GRCm39) L921Q probably damaging Het
Sec22c C A 9: 121,524,750 (GRCm39) R11L probably damaging Het
Skint6 T A 4: 113,034,173 (GRCm39) D318V probably damaging Het
Slc22a28 T C 19: 8,049,205 (GRCm39) N348S probably benign Het
Slc44a2 G T 9: 21,253,305 (GRCm39) K77N possibly damaging Het
Smc1b C T 15: 84,950,431 (GRCm39) V1198I probably benign Het
Spef2 A T 15: 9,717,568 (GRCm39) M316K probably damaging Het
Stra8 T C 6: 34,911,016 (GRCm39) Y215H probably damaging Het
Sv2a G T 3: 96,097,010 (GRCm39) R445L probably benign Het
Sycp1 A C 3: 102,758,944 (GRCm39) L771R probably damaging Het
Tchp A T 5: 114,859,184 (GRCm39) R493* probably null Het
Ttc13 G A 8: 125,410,039 (GRCm39) A391V probably benign Het
Unc13b C T 4: 43,176,186 (GRCm39) T2338I unknown Het
Wac A G 18: 7,921,592 (GRCm39) D576G probably damaging Het
Xdh T C 17: 74,222,688 (GRCm39) N559S probably benign Het
Zscan20 A T 4: 128,481,914 (GRCm39) S583T probably benign Het
Other mutations in Sall2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01587:Sall2 APN 14 52,552,028 (GRCm39) missense probably damaging 1.00
IGL02152:Sall2 APN 14 52,552,971 (GRCm39) missense probably damaging 1.00
IGL02318:Sall2 APN 14 52,553,022 (GRCm39) missense probably damaging 1.00
IGL02933:Sall2 APN 14 52,550,484 (GRCm39) missense probably benign 0.00
IGL03165:Sall2 APN 14 52,551,625 (GRCm39) missense probably damaging 1.00
R1079:Sall2 UTSW 14 52,550,660 (GRCm39) missense probably benign 0.13
R1295:Sall2 UTSW 14 52,551,182 (GRCm39) missense probably damaging 1.00
R1674:Sall2 UTSW 14 52,551,293 (GRCm39) missense probably damaging 1.00
R1840:Sall2 UTSW 14 52,551,182 (GRCm39) missense probably damaging 1.00
R1989:Sall2 UTSW 14 52,551,896 (GRCm39) missense probably damaging 1.00
R2339:Sall2 UTSW 14 52,550,813 (GRCm39) missense probably damaging 1.00
R3407:Sall2 UTSW 14 52,565,561 (GRCm39) missense probably benign 0.03
R3870:Sall2 UTSW 14 52,551,451 (GRCm39) missense probably damaging 1.00
R3895:Sall2 UTSW 14 52,551,504 (GRCm39) missense probably damaging 0.99
R4059:Sall2 UTSW 14 52,552,028 (GRCm39) missense probably damaging 1.00
R4272:Sall2 UTSW 14 52,551,260 (GRCm39) missense probably damaging 1.00
R4273:Sall2 UTSW 14 52,551,260 (GRCm39) missense probably damaging 1.00
R4275:Sall2 UTSW 14 52,551,260 (GRCm39) missense probably damaging 1.00
R4289:Sall2 UTSW 14 52,551,260 (GRCm39) missense probably damaging 1.00
R4503:Sall2 UTSW 14 52,550,916 (GRCm39) missense probably benign
R4592:Sall2 UTSW 14 52,551,260 (GRCm39) missense probably damaging 1.00
R4611:Sall2 UTSW 14 52,551,210 (GRCm39) missense probably damaging 1.00
R4615:Sall2 UTSW 14 52,550,207 (GRCm39) missense probably benign 0.20
R4640:Sall2 UTSW 14 52,552,616 (GRCm39) missense probably damaging 0.99
R4693:Sall2 UTSW 14 52,551,935 (GRCm39) missense probably damaging 1.00
R4921:Sall2 UTSW 14 52,552,850 (GRCm39) missense possibly damaging 0.93
R5007:Sall2 UTSW 14 52,551,950 (GRCm39) missense probably damaging 1.00
R5015:Sall2 UTSW 14 52,553,112 (GRCm39) missense possibly damaging 0.92
R5079:Sall2 UTSW 14 52,552,211 (GRCm39) missense probably damaging 1.00
R5419:Sall2 UTSW 14 52,550,586 (GRCm39) missense probably damaging 1.00
R5849:Sall2 UTSW 14 52,551,704 (GRCm39) missense probably benign 0.13
R6229:Sall2 UTSW 14 52,550,648 (GRCm39) missense probably benign
R6397:Sall2 UTSW 14 52,552,610 (GRCm39) missense probably damaging 1.00
R6422:Sall2 UTSW 14 52,550,181 (GRCm39) makesense probably null
R6456:Sall2 UTSW 14 52,551,051 (GRCm39) nonsense probably null
R6456:Sall2 UTSW 14 52,551,050 (GRCm39) missense probably damaging 1.00
R6786:Sall2 UTSW 14 52,552,078 (GRCm39) missense probably damaging 1.00
R7293:Sall2 UTSW 14 52,551,868 (GRCm39) nonsense probably null
R7496:Sall2 UTSW 14 52,553,018 (GRCm39) missense possibly damaging 0.63
R7792:Sall2 UTSW 14 52,553,521 (GRCm39) missense probably damaging 1.00
R8324:Sall2 UTSW 14 52,550,343 (GRCm39) missense probably benign 0.30
R9017:Sall2 UTSW 14 52,550,719 (GRCm39) missense possibly damaging 0.51
R9362:Sall2 UTSW 14 52,550,601 (GRCm39) nonsense probably null
R9571:Sall2 UTSW 14 52,551,830 (GRCm39) missense probably damaging 1.00
R9574:Sall2 UTSW 14 52,551,617 (GRCm39) missense probably damaging 1.00
R9641:Sall2 UTSW 14 52,550,882 (GRCm39) missense probably damaging 1.00
R9648:Sall2 UTSW 14 52,551,224 (GRCm39) missense probably damaging 1.00
R9694:Sall2 UTSW 14 52,552,124 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CATGGCTTCCGGTAAGTTCAGC -3'
(R):5'- TGAGCAGTCTACAGCCTCTG -3'

Sequencing Primer
(F):5'- GTTCAGCTCTTCCACCAAAGGG -3'
(R):5'- CGTGACAGATGAAGATTCCCTAGC -3'
Posted On 2022-01-20