Mutagenetix > Incidental Mutation

Incidental Mutation 'R9149:Sall2'

694923

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9149 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 52313216 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 841 (D841Y)

Ref Sequence

ENSEMBL: ENSMUSP00000056401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058326
AA Change: D841Y

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: D841Y

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135523
AA Change: D839Y

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (90/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,446,304	S103N	probably benign	Het
Ace	A	G	11: 105,972,473	D358G	possibly damaging	Het
Acvr2b	A	T	9: 119,428,050	H115L	probably damaging	Het
Adam15	G	A	3: 89,347,435	T106I	possibly damaging	Het
Adamts16	A	G	13: 70,735,829	C1076R	probably damaging	Het
Adcy5	A	G	16: 35,272,111	Y614C	probably damaging	Het
Adhfe1	A	T	1: 9,557,051	H225L	probably benign	Het
Aff3	A	G	1: 38,181,316	I1171T	probably damaging	Het
Agps	T	A	2: 75,866,838	M334K	probably damaging	Het
Akr1e1	A	G	13: 4,602,679		probably null	Het
Als2cl	G	A	9: 110,889,123	V311M	probably benign	Het
Amdhd1	A	T	10: 93,539,951	L7H	probably damaging	Het
Apba1	A	T	19: 23,893,418	I205F	probably damaging	Het
Arhgap26	A	T	18: 39,111,864	E187D	possibly damaging	Het
Ash1l	A	T	3: 89,007,223	H1720L	probably benign	Het
Atp9a	T	C	2: 168,734,068		probably benign	Het
Bcl7c	G	A	7: 127,708,523	A2V	probably damaging	Het
Catsperg1	G	C	7: 29,210,487	P72R	probably benign	Het
Ccdc103	G	A	11: 102,884,096	G174R	probably benign	Het
Ccdc171	A	T	4: 83,694,275	K976M	probably damaging	Het
Ceacam1	T	C	7: 25,473,935	N276S	possibly damaging	Het
Cep152	T	C	2: 125,619,883	N91S	probably damaging	Het
Cep152	T	C	2: 125,621,207	E18G	probably damaging	Het
Cers3	T	C	7: 66,743,694	L17P	probably benign	Het
Cpsf3	A	G	12: 21,306,843	N489S	possibly damaging	Het
Cramp1l	A	G	17: 24,968,946	S1225P	probably damaging	Het
Dck	G	A	5: 88,765,307	G18R	probably benign	Het
Dnah5	A	T	15: 28,387,768	E3124D	probably benign	Het
Eogt	T	G	6: 97,113,878	L433F	probably damaging	Het
Fam135b	A	G	15: 71,462,895	S817P		Het
Fsip2	T	C	2: 82,982,030	Y2898H	possibly damaging	Het
Fzr1	T	C	10: 81,369,415	H249R	probably benign	Het
Gbp10	T	G	5: 105,218,995	Q457P	probably damaging	Het
Gin1	G	C	1: 97,783,094	L167F	probably damaging	Het
Gm14226	A	T	2: 155,024,923	I267F	probably damaging	Het
Gmnc	A	G	16: 26,962,892		probably null	Het
Hectd2	A	T	19: 36,599,002	I311F	probably damaging	Het
Heg1	A	G	16: 33,738,591	K1085E	probably benign	Het
Hmbs	G	A	9: 44,341,686	Q34*	probably null	Het
Hyal6	T	A	6: 24,734,152	M28K	probably benign	Het
Ifi27	T	C	12: 103,439,419	V141A	possibly damaging	Het
Ift122	T	A	6: 115,890,531	I414N	probably damaging	Het
Iglv2	A	T	16: 19,260,684	V23E	probably damaging	Het
Itgax	A	T	7: 128,131,469	I120L	probably benign	Het
Kifc3	A	G	8: 95,126,689	I13T	probably benign	Het
Lmod3	T	C	6: 97,247,664	N399D	probably damaging	Het
Macf1	A	T	4: 123,471,533	I3145K	probably benign	Het
Map2k5	A	C	9: 63,293,724	I209S	probably damaging	Het
Mbd5	A	G	2: 49,251,376	E117G	probably damaging	Het
Milr1	A	G	11: 106,761,279	H172R	probably benign	Het
Myod1	A	C	7: 46,377,169	D166A		Het
Neb	C	T	2: 52,210,866	V4647M	possibly damaging	Het
Nek1	A	T	8: 61,121,021	D1101V	probably damaging	Het
Nlrp2	A	T	7: 5,327,573	V608D	probably benign	Het
Noc3l	G	A	19: 38,812,391	Q216*	probably null	Het
Nos1	G	C	5: 117,879,337	R255P	probably benign	Het
Nup160	T	A	2: 90,722,241		probably benign	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Oat	C	T	7: 132,564,277	S193N	probably benign	Het
Olfr1	T	A	11: 73,396,027		probably benign	Het
Olfr1148	G	T	2: 87,833,179	G47*	probably null	Het
Olfr344	T	G	2: 36,568,976	F126C	probably benign	Het
Olfr776	A	G	10: 129,261,315	Y118C	probably damaging	Het
Olfr812	A	G	10: 129,842,613	V143A	probably damaging	Het
Oma1	A	G	4: 103,325,017		probably null	Het
Os9	A	G	10: 127,098,049	S500P	possibly damaging	Het
Osbpl11	A	T	16: 33,227,290	N541I		Het
Pcnx4	A	G	12: 72,566,897	I539V	probably benign	Het
Ppfia3	T	A	7: 45,350,293		probably null	Het
Ppp1r3a	T	C	6: 14,722,099	K275E	probably benign	Het
Pten	A	G	19: 32,792,572	N63S	probably benign	Het
Rptor	A	G	11: 119,887,070	N1020S	probably benign	Het
Sbno1	T	A	5: 124,381,699	H1172L	probably benign	Het
Scaf4	A	T	16: 90,230,166	L921Q	probably damaging	Het
Sec22c	C	A	9: 121,695,684	R11L	probably damaging	Het
Skint6	T	A	4: 113,176,976	D318V	probably damaging	Het
Slc22a28	T	C	19: 8,071,840	N348S	probably benign	Het
Slc44a2	G	T	9: 21,342,009	K77N	possibly damaging	Het
Smc1b	C	T	15: 85,066,230	V1198I	probably benign	Het
Spef2	A	T	15: 9,717,482	M316K	probably damaging	Het
Stra8	T	C	6: 34,934,081	Y215H	probably damaging	Het
Sv2a	G	T	3: 96,189,694	R445L	probably benign	Het
Sycp1	A	C	3: 102,851,628	L771R	probably damaging	Het
Tchp	A	T	5: 114,721,123	R493*	probably null	Het
Ttc13	G	A	8: 124,683,300	A391V	probably benign	Het
Unc13b	C	T	4: 43,176,186	T2338I	unknown	Het
Wac	A	G	18: 7,921,592	D576G	probably damaging	Het
Wdr34	T	A	2: 30,033,941	T191S	probably benign	Het
Xdh	T	C	17: 73,915,693	N559S	probably benign	Het
Zscan20	A	T	4: 128,588,121	S583T	probably benign	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- CATGGCTTCCGGTAAGTTCAGC -3'
(R):5'- TGAGCAGTCTACAGCCTCTG -3'

Sequencing Primer
(F):5'- GTTCAGCTCTTCCACCAAAGGG -3'
(R):5'- CGTGACAGATGAAGATTCCCTAGC -3'

Posted On

2022-01-20