Incidental Mutation 'R9149:Smc1b'
ID 694927
Institutional Source Beutler Lab
Gene Symbol Smc1b
Ensembl Gene ENSMUSG00000022432
Gene Name structural maintenance of chromosomes 1B
Synonyms SMC1beta, Smc1l2
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.691) question?
Stock # R9149 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 85064689-85131964 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 85066230 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1198 (V1198I)
Ref Sequence ENSEMBL: ENSMUSP00000023068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023068] [ENSMUST00000023069] [ENSMUST00000227591] [ENSMUST00000229203]
AlphaFold Q920F6
Predicted Effect probably benign
Transcript: ENSMUST00000023068
AA Change: V1198I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432
AA Change: V1198I

DomainStartEndE-ValueType
Pfam:AAA_23 7 361 2e-10 PFAM
Pfam:AAA_21 27 372 7.2e-9 PFAM
low complexity region 422 437 N/A INTRINSIC
SMC_hinge 513 629 1.5e-23 SMART
PDB:1W1W|D 1046 1218 3e-42 PDB
Blast:AAA 1063 1217 5e-25 BLAST
SCOP:d1e69a_ 1114 1202 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000023069
SMART Domains Protein: ENSMUSP00000023069
Gene: ENSMUSG00000022434

DomainStartEndE-ValueType
Pfam:SIR2_2 142 286 7.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227591
Predicted Effect probably benign
Transcript: ENSMUST00000229203
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMC1L2 belongs to a family of proteins required for chromatid cohesion and DNA recombination during meiosis and mitosis (3:Revenkova et al., 2001 [PubMed 11564881]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice display male and female infertility, abnormal male and female meiosis, and arrest of spematogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,446,304 S103N probably benign Het
Ace A G 11: 105,972,473 D358G possibly damaging Het
Acvr2b A T 9: 119,428,050 H115L probably damaging Het
Adam15 G A 3: 89,347,435 T106I possibly damaging Het
Adamts16 A G 13: 70,735,829 C1076R probably damaging Het
Adcy5 A G 16: 35,272,111 Y614C probably damaging Het
Adhfe1 A T 1: 9,557,051 H225L probably benign Het
Aff3 A G 1: 38,181,316 I1171T probably damaging Het
Agps T A 2: 75,866,838 M334K probably damaging Het
Akr1e1 A G 13: 4,602,679 probably null Het
Als2cl G A 9: 110,889,123 V311M probably benign Het
Amdhd1 A T 10: 93,539,951 L7H probably damaging Het
Apba1 A T 19: 23,893,418 I205F probably damaging Het
Arhgap26 A T 18: 39,111,864 E187D possibly damaging Het
Ash1l A T 3: 89,007,223 H1720L probably benign Het
Atp9a T C 2: 168,734,068 probably benign Het
Bcl7c G A 7: 127,708,523 A2V probably damaging Het
Catsperg1 G C 7: 29,210,487 P72R probably benign Het
Ccdc103 G A 11: 102,884,096 G174R probably benign Het
Ccdc171 A T 4: 83,694,275 K976M probably damaging Het
Ceacam1 T C 7: 25,473,935 N276S possibly damaging Het
Cep152 T C 2: 125,619,883 N91S probably damaging Het
Cep152 T C 2: 125,621,207 E18G probably damaging Het
Cers3 T C 7: 66,743,694 L17P probably benign Het
Cpsf3 A G 12: 21,306,843 N489S possibly damaging Het
Cramp1l A G 17: 24,968,946 S1225P probably damaging Het
Dck G A 5: 88,765,307 G18R probably benign Het
Dnah5 A T 15: 28,387,768 E3124D probably benign Het
Eogt T G 6: 97,113,878 L433F probably damaging Het
Fam135b A G 15: 71,462,895 S817P Het
Fsip2 T C 2: 82,982,030 Y2898H possibly damaging Het
Fzr1 T C 10: 81,369,415 H249R probably benign Het
Gbp10 T G 5: 105,218,995 Q457P probably damaging Het
Gin1 G C 1: 97,783,094 L167F probably damaging Het
Gm14226 A T 2: 155,024,923 I267F probably damaging Het
Gmnc A G 16: 26,962,892 probably null Het
Hectd2 A T 19: 36,599,002 I311F probably damaging Het
Heg1 A G 16: 33,738,591 K1085E probably benign Het
Hmbs G A 9: 44,341,686 Q34* probably null Het
Hyal6 T A 6: 24,734,152 M28K probably benign Het
Ifi27 T C 12: 103,439,419 V141A possibly damaging Het
Ift122 T A 6: 115,890,531 I414N probably damaging Het
Iglv2 A T 16: 19,260,684 V23E probably damaging Het
Itgax A T 7: 128,131,469 I120L probably benign Het
Kifc3 A G 8: 95,126,689 I13T probably benign Het
Lmod3 T C 6: 97,247,664 N399D probably damaging Het
Macf1 A T 4: 123,471,533 I3145K probably benign Het
Map2k5 A C 9: 63,293,724 I209S probably damaging Het
Mbd5 A G 2: 49,251,376 E117G probably damaging Het
Milr1 A G 11: 106,761,279 H172R probably benign Het
Myod1 A C 7: 46,377,169 D166A Het
Neb C T 2: 52,210,866 V4647M possibly damaging Het
Nek1 A T 8: 61,121,021 D1101V probably damaging Het
Nlrp2 A T 7: 5,327,573 V608D probably benign Het
Noc3l G A 19: 38,812,391 Q216* probably null Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nup160 T A 2: 90,722,241 probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Oat C T 7: 132,564,277 S193N probably benign Het
Olfr1 T A 11: 73,396,027 probably benign Het
Olfr1148 G T 2: 87,833,179 G47* probably null Het
Olfr344 T G 2: 36,568,976 F126C probably benign Het
Olfr776 A G 10: 129,261,315 Y118C probably damaging Het
Olfr812 A G 10: 129,842,613 V143A probably damaging Het
Oma1 A G 4: 103,325,017 probably null Het
Os9 A G 10: 127,098,049 S500P possibly damaging Het
Osbpl11 A T 16: 33,227,290 N541I Het
Pcnx4 A G 12: 72,566,897 I539V probably benign Het
Ppfia3 T A 7: 45,350,293 probably null Het
Ppp1r3a T C 6: 14,722,099 K275E probably benign Het
Pten A G 19: 32,792,572 N63S probably benign Het
Rptor A G 11: 119,887,070 N1020S probably benign Het
Sall2 C A 14: 52,313,216 D841Y possibly damaging Het
Sbno1 T A 5: 124,381,699 H1172L probably benign Het
Scaf4 A T 16: 90,230,166 L921Q probably damaging Het
Sec22c C A 9: 121,695,684 R11L probably damaging Het
Skint6 T A 4: 113,176,976 D318V probably damaging Het
Slc22a28 T C 19: 8,071,840 N348S probably benign Het
Slc44a2 G T 9: 21,342,009 K77N possibly damaging Het
Spef2 A T 15: 9,717,482 M316K probably damaging Het
Stra8 T C 6: 34,934,081 Y215H probably damaging Het
Sv2a G T 3: 96,189,694 R445L probably benign Het
Sycp1 A C 3: 102,851,628 L771R probably damaging Het
Tchp A T 5: 114,721,123 R493* probably null Het
Ttc13 G A 8: 124,683,300 A391V probably benign Het
Unc13b C T 4: 43,176,186 T2338I unknown Het
Wac A G 18: 7,921,592 D576G probably damaging Het
Wdr34 T A 2: 30,033,941 T191S probably benign Het
Xdh T C 17: 73,915,693 N559S probably benign Het
Zscan20 A T 4: 128,588,121 S583T probably benign Het
Other mutations in Smc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Smc1b APN 15 85129700 missense possibly damaging 0.95
IGL01293:Smc1b APN 15 85131898 missense probably damaging 1.00
IGL01656:Smc1b APN 15 85114776 missense probably damaging 0.99
IGL01807:Smc1b APN 15 85096745 missense probably damaging 0.97
IGL02094:Smc1b APN 15 85097891 splice site probably benign
IGL02121:Smc1b APN 15 85097985 missense probably benign
IGL02631:Smc1b APN 15 85107003 missense probably damaging 0.98
IGL02678:Smc1b APN 15 85065000 nonsense probably null
IGL03197:Smc1b APN 15 85070863 missense possibly damaging 0.85
IGL03214:Smc1b APN 15 85097946 nonsense probably null
IGL03218:Smc1b APN 15 85089713 missense probably benign 0.07
IGL03232:Smc1b APN 15 85129720 missense possibly damaging 0.68
adamantine UTSW 15 85121641 missense probably benign 0.06
unbreakable UTSW 15 85096658 missense probably benign
E0370:Smc1b UTSW 15 85127581 missense probably damaging 1.00
PIT4812001:Smc1b UTSW 15 85069651 missense possibly damaging 0.91
R0092:Smc1b UTSW 15 85067724 unclassified probably benign
R0106:Smc1b UTSW 15 85070819 missense probably damaging 1.00
R0106:Smc1b UTSW 15 85070819 missense probably damaging 1.00
R0207:Smc1b UTSW 15 85123759 missense probably benign
R0390:Smc1b UTSW 15 85066277 missense probably damaging 1.00
R0440:Smc1b UTSW 15 85112673 splice site probably benign
R0685:Smc1b UTSW 15 85070820 missense possibly damaging 0.92
R1109:Smc1b UTSW 15 85112815 missense probably damaging 0.98
R1392:Smc1b UTSW 15 85107070 splice site probably benign
R1509:Smc1b UTSW 15 85086134 missense probably benign
R1804:Smc1b UTSW 15 85127790 missense possibly damaging 0.90
R1879:Smc1b UTSW 15 85092067 missense probably benign 0.01
R2086:Smc1b UTSW 15 85121851 splice site probably benign
R2143:Smc1b UTSW 15 85123802 missense probably benign
R2158:Smc1b UTSW 15 85121851 splice site probably benign
R2174:Smc1b UTSW 15 85121851 splice site probably benign
R2471:Smc1b UTSW 15 85092017 missense probably damaging 0.98
R3689:Smc1b UTSW 15 85117263 intron probably benign
R3690:Smc1b UTSW 15 85117263 intron probably benign
R4178:Smc1b UTSW 15 85120647 missense possibly damaging 0.94
R4420:Smc1b UTSW 15 85112830 missense probably damaging 1.00
R4905:Smc1b UTSW 15 85066227 missense probably damaging 1.00
R4919:Smc1b UTSW 15 85117104 intron probably benign
R5114:Smc1b UTSW 15 85064984 missense probably damaging 1.00
R5314:Smc1b UTSW 15 85070865 missense probably benign 0.00
R5476:Smc1b UTSW 15 85086151 missense probably damaging 0.97
R5593:Smc1b UTSW 15 85121641 missense probably benign 0.06
R5690:Smc1b UTSW 15 85112773 missense probably damaging 1.00
R5719:Smc1b UTSW 15 85096658 missense probably benign
R5817:Smc1b UTSW 15 85067783 missense probably damaging 0.99
R5834:Smc1b UTSW 15 85089665 missense probably damaging 1.00
R5930:Smc1b UTSW 15 85086121 missense probably damaging 1.00
R6032:Smc1b UTSW 15 85066229 missense possibly damaging 0.92
R6032:Smc1b UTSW 15 85066229 missense possibly damaging 0.92
R6049:Smc1b UTSW 15 85121695 missense probably damaging 1.00
R6306:Smc1b UTSW 15 85127623 missense probably benign 0.30
R6392:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6426:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6435:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6436:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6437:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6508:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6512:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6703:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6737:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6775:Smc1b UTSW 15 85089680 missense probably damaging 0.96
R6889:Smc1b UTSW 15 85067759 missense probably damaging 1.00
R6908:Smc1b UTSW 15 85107010 missense probably damaging 1.00
R7124:Smc1b UTSW 15 85071597 missense probably damaging 0.98
R7400:Smc1b UTSW 15 85069720 missense probably damaging 1.00
R7417:Smc1b UTSW 15 85097542 missense probably benign 0.05
R7610:Smc1b UTSW 15 85070820 missense possibly damaging 0.92
R7873:Smc1b UTSW 15 85110650 critical splice donor site probably null
R7890:Smc1b UTSW 15 85066328 missense probably damaging 1.00
R8004:Smc1b UTSW 15 85097614 missense probably damaging 0.98
R8698:Smc1b UTSW 15 85112846 missense probably benign 0.16
R8826:Smc1b UTSW 15 85066328 missense probably damaging 1.00
R8835:Smc1b UTSW 15 85129748 missense possibly damaging 0.83
R8925:Smc1b UTSW 15 85107072 splice site probably null
R9059:Smc1b UTSW 15 85120674 nonsense probably null
R9241:Smc1b UTSW 15 85092008 missense probably benign 0.00
R9245:Smc1b UTSW 15 85120645 missense probably benign 0.03
R9301:Smc1b UTSW 15 85127794 missense probably damaging 0.98
R9384:Smc1b UTSW 15 85066254 missense probably damaging 0.99
R9750:Smc1b UTSW 15 85131905 missense probably damaging 1.00
Z1176:Smc1b UTSW 15 85131903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATATTTACTCGTGTGTGGG -3'
(R):5'- TTGTTCCCAGAGCCCAAAG -3'

Sequencing Primer
(F):5'- ACGTGGGTCTCAGTGATCAAACTC -3'
(R):5'- AGCCCAAAGGAGGCCTTG -3'
Posted On 2022-01-20