Incidental Mutation 'R9149:Cramp1'
ID 694934
Institutional Source Beutler Lab
Gene Symbol Cramp1
Ensembl Gene ENSMUSG00000038002
Gene Name cramped chromatin regulator 1
Synonyms 5830477H08Rik, Tce4, Cramp1l
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9149 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 25180200-25234762 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25187920 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1225 (S1225P)
Ref Sequence ENSEMBL: ENSMUSP00000073060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073337]
AlphaFold Q6PG95
Predicted Effect probably damaging
Transcript: ENSMUST00000073337
AA Change: S1225P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073060
Gene: ENSMUSG00000038002
AA Change: S1225P

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
low complexity region 51 64 N/A INTRINSIC
low complexity region 100 126 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
SANT 159 219 3.68e-3 SMART
low complexity region 479 503 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 833 845 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
low complexity region 1069 1086 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1141 1156 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (90/90)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,396,304 (GRCm39) S103N probably benign Het
Ace A G 11: 105,863,299 (GRCm39) D358G possibly damaging Het
Acvr2b A T 9: 119,257,116 (GRCm39) H115L probably damaging Het
Adam15 G A 3: 89,254,742 (GRCm39) T106I possibly damaging Het
Adamts16 A G 13: 70,883,948 (GRCm39) C1076R probably damaging Het
Adcy5 A G 16: 35,092,481 (GRCm39) Y614C probably damaging Het
Adhfe1 A T 1: 9,627,276 (GRCm39) H225L probably benign Het
Aff3 A G 1: 38,220,397 (GRCm39) I1171T probably damaging Het
Agps T A 2: 75,697,182 (GRCm39) M334K probably damaging Het
Akr1e1 A G 13: 4,652,678 (GRCm39) probably null Het
Als2cl G A 9: 110,718,191 (GRCm39) V311M probably benign Het
Amdhd1 A T 10: 93,375,813 (GRCm39) L7H probably damaging Het
Apba1 A T 19: 23,870,782 (GRCm39) I205F probably damaging Het
Arhgap26 A T 18: 39,244,917 (GRCm39) E187D possibly damaging Het
Ash1l A T 3: 88,914,530 (GRCm39) H1720L probably benign Het
Atp9a T C 2: 168,575,988 (GRCm39) probably benign Het
Bcl7c G A 7: 127,307,695 (GRCm39) A2V probably damaging Het
Catsperg1 G C 7: 28,909,912 (GRCm39) P72R probably benign Het
Ccdc103 G A 11: 102,774,922 (GRCm39) G174R probably benign Het
Ccdc171 A T 4: 83,612,512 (GRCm39) K976M probably damaging Het
Ceacam1 T C 7: 25,173,360 (GRCm39) N276S possibly damaging Het
Cep152 T C 2: 125,463,127 (GRCm39) E18G probably damaging Het
Cep152 T C 2: 125,461,803 (GRCm39) N91S probably damaging Het
Cers3 T C 7: 66,393,442 (GRCm39) L17P probably benign Het
Cpsf3 A G 12: 21,356,844 (GRCm39) N489S possibly damaging Het
Dck G A 5: 88,913,166 (GRCm39) G18R probably benign Het
Dnah5 A T 15: 28,387,914 (GRCm39) E3124D probably benign Het
Dync2i2 T A 2: 29,923,953 (GRCm39) T191S probably benign Het
Eogt T G 6: 97,090,839 (GRCm39) L433F probably damaging Het
Fam135b A G 15: 71,334,744 (GRCm39) S817P Het
Fsip2 T C 2: 82,812,374 (GRCm39) Y2898H possibly damaging Het
Fzr1 T C 10: 81,205,249 (GRCm39) H249R probably benign Het
Gbp10 T G 5: 105,366,861 (GRCm39) Q457P probably damaging Het
Gin1 G C 1: 97,710,819 (GRCm39) L167F probably damaging Het
Gm14226 A T 2: 154,866,843 (GRCm39) I267F probably damaging Het
Gmnc A G 16: 26,781,642 (GRCm39) probably null Het
Hectd2 A T 19: 36,576,402 (GRCm39) I311F probably damaging Het
Heg1 A G 16: 33,558,961 (GRCm39) K1085E probably benign Het
Hmbs G A 9: 44,252,983 (GRCm39) Q34* probably null Het
Hyal6 T A 6: 24,734,151 (GRCm39) M28K probably benign Het
Ifi27l2a T C 12: 103,405,678 (GRCm39) V141A possibly damaging Het
Ift122 T A 6: 115,867,492 (GRCm39) I414N probably damaging Het
Iglv2 A T 16: 19,079,434 (GRCm39) V23E probably damaging Het
Itgax A T 7: 127,730,641 (GRCm39) I120L probably benign Het
Kifc3 A G 8: 95,853,317 (GRCm39) I13T probably benign Het
Lmod3 T C 6: 97,224,625 (GRCm39) N399D probably damaging Het
Macf1 A T 4: 123,365,326 (GRCm39) I3145K probably benign Het
Map2k5 A C 9: 63,201,006 (GRCm39) I209S probably damaging Het
Mbd5 A G 2: 49,141,388 (GRCm39) E117G probably damaging Het
Milr1 A G 11: 106,652,105 (GRCm39) H172R probably benign Het
Myod1 A C 7: 46,026,593 (GRCm39) D166A Het
Neb C T 2: 52,100,878 (GRCm39) V4647M possibly damaging Het
Nek1 A T 8: 61,574,055 (GRCm39) D1101V probably damaging Het
Nlrp2 A T 7: 5,330,572 (GRCm39) V608D probably benign Het
Noc3l G A 19: 38,800,835 (GRCm39) Q216* probably null Het
Nos1 G C 5: 118,017,402 (GRCm39) R255P probably benign Het
Nup160 T A 2: 90,552,585 (GRCm39) probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Oat C T 7: 132,166,006 (GRCm39) S193N probably benign Het
Oma1 A G 4: 103,182,214 (GRCm39) probably null Het
Or12e13 G T 2: 87,663,523 (GRCm39) G47* probably null Het
Or1e16 T A 11: 73,286,853 (GRCm39) probably benign Het
Or1j15 T G 2: 36,458,988 (GRCm39) F126C probably benign Het
Or6c206 A G 10: 129,097,184 (GRCm39) Y118C probably damaging Het
Or6c216 A G 10: 129,678,482 (GRCm39) V143A probably damaging Het
Os9 A G 10: 126,933,918 (GRCm39) S500P possibly damaging Het
Osbpl11 A T 16: 33,047,660 (GRCm39) N541I Het
Pcnx4 A G 12: 72,613,671 (GRCm39) I539V probably benign Het
Ppfia3 T A 7: 44,999,717 (GRCm39) probably null Het
Ppp1r3a T C 6: 14,722,098 (GRCm39) K275E probably benign Het
Pten A G 19: 32,769,972 (GRCm39) N63S probably benign Het
Rptor A G 11: 119,777,896 (GRCm39) N1020S probably benign Het
Sall2 C A 14: 52,550,673 (GRCm39) D841Y possibly damaging Het
Sbno1 T A 5: 124,519,762 (GRCm39) H1172L probably benign Het
Scaf4 A T 16: 90,027,054 (GRCm39) L921Q probably damaging Het
Sec22c C A 9: 121,524,750 (GRCm39) R11L probably damaging Het
Skint6 T A 4: 113,034,173 (GRCm39) D318V probably damaging Het
Slc22a28 T C 19: 8,049,205 (GRCm39) N348S probably benign Het
Slc44a2 G T 9: 21,253,305 (GRCm39) K77N possibly damaging Het
Smc1b C T 15: 84,950,431 (GRCm39) V1198I probably benign Het
Spef2 A T 15: 9,717,568 (GRCm39) M316K probably damaging Het
Stra8 T C 6: 34,911,016 (GRCm39) Y215H probably damaging Het
Sv2a G T 3: 96,097,010 (GRCm39) R445L probably benign Het
Sycp1 A C 3: 102,758,944 (GRCm39) L771R probably damaging Het
Tchp A T 5: 114,859,184 (GRCm39) R493* probably null Het
Ttc13 G A 8: 125,410,039 (GRCm39) A391V probably benign Het
Unc13b C T 4: 43,176,186 (GRCm39) T2338I unknown Het
Wac A G 18: 7,921,592 (GRCm39) D576G probably damaging Het
Xdh T C 17: 74,222,688 (GRCm39) N559S probably benign Het
Zscan20 A T 4: 128,481,914 (GRCm39) S583T probably benign Het
Other mutations in Cramp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Cramp1 APN 17 25,202,925 (GRCm39) missense probably benign 0.11
IGL01360:Cramp1 APN 17 25,216,547 (GRCm39) missense probably damaging 1.00
IGL01966:Cramp1 APN 17 25,201,917 (GRCm39) missense probably benign 0.01
IGL02211:Cramp1 APN 17 25,196,610 (GRCm39) missense possibly damaging 0.94
IGL02474:Cramp1 APN 17 25,204,024 (GRCm39) missense probably damaging 0.98
IGL02798:Cramp1 APN 17 25,187,894 (GRCm39) splice site probably benign
IGL03340:Cramp1 APN 17 25,192,516 (GRCm39) missense probably damaging 1.00
Interred UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R0106:Cramp1 UTSW 17 25,191,350 (GRCm39) missense probably benign 0.30
R1054:Cramp1 UTSW 17 25,202,151 (GRCm39) missense probably damaging 1.00
R1220:Cramp1 UTSW 17 25,201,211 (GRCm39) missense probably damaging 1.00
R1341:Cramp1 UTSW 17 25,196,514 (GRCm39) missense probably damaging 1.00
R1491:Cramp1 UTSW 17 25,191,323 (GRCm39) missense probably benign 0.17
R1610:Cramp1 UTSW 17 25,202,925 (GRCm39) missense probably benign 0.11
R1649:Cramp1 UTSW 17 25,202,217 (GRCm39) missense probably damaging 1.00
R1795:Cramp1 UTSW 17 25,183,884 (GRCm39) missense probably damaging 1.00
R1856:Cramp1 UTSW 17 25,187,952 (GRCm39) missense probably damaging 1.00
R1881:Cramp1 UTSW 17 25,196,656 (GRCm39) splice site probably benign
R1968:Cramp1 UTSW 17 25,183,913 (GRCm39) missense probably damaging 1.00
R2047:Cramp1 UTSW 17 25,222,189 (GRCm39) nonsense probably null
R2099:Cramp1 UTSW 17 25,192,059 (GRCm39) missense probably benign 0.01
R2298:Cramp1 UTSW 17 25,216,454 (GRCm39) missense probably damaging 0.96
R3752:Cramp1 UTSW 17 25,190,532 (GRCm39) missense probably damaging 1.00
R3821:Cramp1 UTSW 17 25,193,756 (GRCm39) missense probably damaging 1.00
R3861:Cramp1 UTSW 17 25,216,588 (GRCm39) splice site probably benign
R4399:Cramp1 UTSW 17 25,198,559 (GRCm39) missense probably damaging 1.00
R4847:Cramp1 UTSW 17 25,204,063 (GRCm39) missense probably damaging 1.00
R4883:Cramp1 UTSW 17 25,201,293 (GRCm39) missense probably benign
R5579:Cramp1 UTSW 17 25,192,087 (GRCm39) missense possibly damaging 0.89
R5631:Cramp1 UTSW 17 25,204,577 (GRCm39) missense possibly damaging 0.93
R5716:Cramp1 UTSW 17 25,193,709 (GRCm39) missense probably damaging 0.99
R6589:Cramp1 UTSW 17 25,196,466 (GRCm39) splice site probably null
R6631:Cramp1 UTSW 17 25,202,931 (GRCm39) missense probably benign 0.40
R7307:Cramp1 UTSW 17 25,193,719 (GRCm39) missense possibly damaging 0.94
R7323:Cramp1 UTSW 17 25,201,379 (GRCm39) missense possibly damaging 0.90
R7672:Cramp1 UTSW 17 25,201,440 (GRCm39) missense probably damaging 0.96
R7832:Cramp1 UTSW 17 25,202,196 (GRCm39) missense probably damaging 0.96
R8071:Cramp1 UTSW 17 25,201,674 (GRCm39) missense probably damaging 0.99
R8244:Cramp1 UTSW 17 25,190,384 (GRCm39) missense probably damaging 1.00
R8430:Cramp1 UTSW 17 25,196,536 (GRCm39) missense probably damaging 1.00
R8783:Cramp1 UTSW 17 25,193,732 (GRCm39) missense probably damaging 0.99
R8890:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8892:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8894:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8937:Cramp1 UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R8941:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R9029:Cramp1 UTSW 17 25,232,884 (GRCm39) missense probably damaging 1.00
R9047:Cramp1 UTSW 17 25,198,603 (GRCm39) missense possibly damaging 0.90
R9262:Cramp1 UTSW 17 25,232,920 (GRCm39) missense probably damaging 0.99
R9460:Cramp1 UTSW 17 25,222,281 (GRCm39) missense probably damaging 1.00
R9614:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9615:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9651:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9652:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9653:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9665:Cramp1 UTSW 17 25,196,545 (GRCm39) missense probably damaging 1.00
R9753:Cramp1 UTSW 17 25,191,320 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CAAGTGCTGCCAGATCTCTC -3'
(R):5'- TGGGTAGCCCTTGACACAAG -3'

Sequencing Primer
(F):5'- TGCTGCCAGATCTCTCAGAGAC -3'
(R):5'- TAGAGGGCCCTGACTAGGCTAC -3'
Posted On 2022-01-20