Incidental Mutation 'R9149:Xdh'
ID 694935
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms xanthine oxidase, XO, Xor, Xox1, Xox-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock # R9149 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 73883908-73950182 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73915693 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 559 (N559S)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably benign
Transcript: ENSMUST00000024866
AA Change: N559S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: N559S

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,446,304 S103N probably benign Het
Ace A G 11: 105,972,473 D358G possibly damaging Het
Acvr2b A T 9: 119,428,050 H115L probably damaging Het
Adam15 G A 3: 89,347,435 T106I possibly damaging Het
Adamts16 A G 13: 70,735,829 C1076R probably damaging Het
Adcy5 A G 16: 35,272,111 Y614C probably damaging Het
Adhfe1 A T 1: 9,557,051 H225L probably benign Het
Aff3 A G 1: 38,181,316 I1171T probably damaging Het
Agps T A 2: 75,866,838 M334K probably damaging Het
Akr1e1 A G 13: 4,602,679 probably null Het
Als2cl G A 9: 110,889,123 V311M probably benign Het
Amdhd1 A T 10: 93,539,951 L7H probably damaging Het
Apba1 A T 19: 23,893,418 I205F probably damaging Het
Arhgap26 A T 18: 39,111,864 E187D possibly damaging Het
Ash1l A T 3: 89,007,223 H1720L probably benign Het
Bcl7c G A 7: 127,708,523 A2V probably damaging Het
Catsperg1 G C 7: 29,210,487 P72R probably benign Het
Ccdc103 G A 11: 102,884,096 G174R probably benign Het
Ccdc171 A T 4: 83,694,275 K976M probably damaging Het
Ceacam1 T C 7: 25,473,935 N276S possibly damaging Het
Cep152 T C 2: 125,619,883 N91S probably damaging Het
Cep152 T C 2: 125,621,207 E18G probably damaging Het
Cers3 T C 7: 66,743,694 L17P probably benign Het
Cpsf3 A G 12: 21,306,843 N489S possibly damaging Het
Cramp1l A G 17: 24,968,946 S1225P probably damaging Het
Dck G A 5: 88,765,307 G18R probably benign Het
Dnah5 A T 15: 28,387,768 E3124D probably benign Het
Eogt T G 6: 97,113,878 L433F probably damaging Het
Fam135b A G 15: 71,462,895 S817P Het
Fsip2 T C 2: 82,982,030 Y2898H possibly damaging Het
Fzr1 T C 10: 81,369,415 H249R probably benign Het
Gbp10 T G 5: 105,218,995 Q457P probably damaging Het
Gin1 G C 1: 97,783,094 L167F probably damaging Het
Gm14226 A T 2: 155,024,923 I267F probably damaging Het
Gmnc A G 16: 26,962,892 probably null Het
Hectd2 A T 19: 36,599,002 I311F probably damaging Het
Heg1 A G 16: 33,738,591 K1085E probably benign Het
Hmbs G A 9: 44,341,686 Q34* probably null Het
Hyal6 T A 6: 24,734,152 M28K probably benign Het
Ifi27 T C 12: 103,439,419 V141A possibly damaging Het
Ift122 T A 6: 115,890,531 I414N probably damaging Het
Iglv2 A T 16: 19,260,684 V23E probably damaging Het
Itgax A T 7: 128,131,469 I120L probably benign Het
Kifc3 A G 8: 95,126,689 I13T probably benign Het
Lmod3 T C 6: 97,247,664 N399D probably damaging Het
Macf1 A T 4: 123,471,533 I3145K probably benign Het
Map2k5 A C 9: 63,293,724 I209S probably damaging Het
Mbd5 A G 2: 49,251,376 E117G probably damaging Het
Milr1 A G 11: 106,761,279 H172R probably benign Het
Myod1 A C 7: 46,377,169 D166A Het
Neb C T 2: 52,210,866 V4647M possibly damaging Het
Nek1 A T 8: 61,121,021 D1101V probably damaging Het
Nlrp2 A T 7: 5,327,573 V608D probably benign Het
Noc3l G A 19: 38,812,391 Q216* probably null Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Oat C T 7: 132,564,277 S193N probably benign Het
Olfr1 T A 11: 73,396,027 probably benign Het
Olfr1148 G T 2: 87,833,179 G47* probably null Het
Olfr344 T G 2: 36,568,976 F126C probably benign Het
Olfr776 A G 10: 129,261,315 Y118C probably damaging Het
Olfr812 A G 10: 129,842,613 V143A probably damaging Het
Oma1 A G 4: 103,325,017 probably null Het
Os9 A G 10: 127,098,049 S500P possibly damaging Het
Osbpl11 A T 16: 33,227,290 N541I Het
Pcnx4 A G 12: 72,566,897 I539V probably benign Het
Ppfia3 T A 7: 45,350,293 probably null Het
Ppp1r3a T C 6: 14,722,099 K275E probably benign Het
Pten A G 19: 32,792,572 N63S probably benign Het
Rptor A G 11: 119,887,070 N1020S probably benign Het
Sall2 C A 14: 52,313,216 D841Y possibly damaging Het
Sbno1 T A 5: 124,381,699 H1172L probably benign Het
Scaf4 A T 16: 90,230,166 L921Q probably damaging Het
Sec22c C A 9: 121,695,684 R11L probably damaging Het
Skint6 T A 4: 113,176,976 D318V probably damaging Het
Slc22a28 T C 19: 8,071,840 N348S probably benign Het
Slc44a2 G T 9: 21,342,009 K77N possibly damaging Het
Smc1b C T 15: 85,066,230 V1198I probably benign Het
Spef2 A T 15: 9,717,482 M316K probably damaging Het
Stra8 T C 6: 34,934,081 Y215H probably damaging Het
Sv2a G T 3: 96,189,694 R445L probably benign Het
Sycp1 A C 3: 102,851,628 L771R probably damaging Het
Tchp A T 5: 114,721,123 R493* probably null Het
Ttc13 G A 8: 124,683,300 A391V probably benign Het
Unc13b C T 4: 43,176,186 T2338I unknown Het
Wac A G 18: 7,921,592 D576G probably damaging Het
Wdr34 T A 2: 30,033,941 T191S probably benign Het
Zscan20 A T 4: 128,588,121 S583T probably benign Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0319:Xdh UTSW 17 73906101 splice site probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4356:Xdh UTSW 17 73915690 missense probably benign 0.01
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4523:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4600:Xdh UTSW 17 73910200 missense probably benign 0.19
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4897:Xdh UTSW 17 73900708 missense probably benign
R4923:Xdh UTSW 17 73924936 missense possibly damaging 0.72
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5030:Xdh UTSW 17 73891293 missense probably damaging 1.00
R5185:Xdh UTSW 17 73925011 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6058:Xdh UTSW 17 73906269 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8346:Xdh UTSW 17 73913943 missense probably damaging 1.00
R8350:Xdh UTSW 17 73934842 missense probably damaging 1.00
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
R8465:Xdh UTSW 17 73899012 nonsense probably null
R8478:Xdh UTSW 17 73906058 missense probably benign 0.00
R8680:Xdh UTSW 17 73922505 missense probably benign
R8802:Xdh UTSW 17 73918410 missense probably benign 0.00
R8984:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8985:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8995:Xdh UTSW 17 73898374 missense probably damaging 1.00
R9035:Xdh UTSW 17 73910227 missense probably benign
R9181:Xdh UTSW 17 73925011 missense probably damaging 1.00
R9357:Xdh UTSW 17 73907716 missense probably damaging 0.97
R9357:Xdh UTSW 17 73926546 critical splice donor site probably null
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGATAGCTGCAGTGGC -3'
(R):5'- GATCCAGCACTGTATTCAAAACTC -3'

Sequencing Primer
(F):5'- AGTGGCAGCAGTGTGGCTC -3'
(R):5'- CTGAGGGGATGGGGGATG -3'
Posted On 2022-01-20