Mutagenetix > Incidental Mutations

Incidental Mutation 'R0766:Fry'

69495

Institutional Source

Beutler Lab

Gene Symbol

Fry

Ensembl Gene

ENSMUSG00000056602

Gene Name

FRY microtubule binding protein

Synonyms

9330186A19Rik, cg003

MMRRC Submission

038946-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.644) question?

Stock #

R0766 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

150118645-150497753 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 150403432 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000084454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087204]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000087204

SMART Domains

Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602

Domain	Start	End	E-Value	Type
Pfam:MOR2-PAG1_N	165	697	5.3e-170	PFAM
low complexity region	1014	1040	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	1188	1380	1.2e-15	PFAM
Pfam:MOR2-PAG1_mid	1398	1534	1.5e-5	PFAM
Pfam:MOR2-PAG1_mid	1632	1704	1.8e-7	PFAM
Pfam:MOR2-PAG1_mid	1772	1906	4.9e-10	PFAM
low complexity region	1936	1956	N/A	INTRINSIC
low complexity region	1962	1980	N/A	INTRINSIC
Pfam:MOR2-PAG1_C	2050	2303	1.9e-74	PFAM
low complexity region	2369	2385	N/A	INTRINSIC
low complexity region	2463	2482	N/A	INTRINSIC
low complexity region	2525	2534	N/A	INTRINSIC
low complexity region	2836	2852	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200964

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 93.4%

Validation Efficiency

100% (37/37)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	A	T	4: 103,270,797	F44I	probably damaging	Het
A2m	T	C	6: 121,676,890		probably benign	Het
Card14	T	C	11: 119,324,176	S241P	probably damaging	Het
Cdh15	G	A	8: 122,861,449		probably benign	Het
Dnah5	A	C	15: 28,448,487	K4232T	probably null	Het
Eml6	A	G	11: 29,831,219		probably benign	Het
Esd	T	C	14: 74,742,121	S122P	probably damaging	Het
Frem3	G	A	8: 80,615,322	V1415I	probably benign	Het
Gp1ba	C	T	11: 70,641,427	P673L	probably damaging	Het
Herc1	C	T	9: 66,504,840	P4781S	probably damaging	Het
Iqch	G	A	9: 63,482,683	S738L	probably benign	Het
Itih2	T	A	2: 10,097,924	T800S	probably benign	Het
Itpr1	A	G	6: 108,410,900	E1533G	probably damaging	Het
Klrg1	T	C	6: 122,279,663	M55V	probably benign	Het
Lrrk2	A	G	15: 91,699,895	N286S	probably damaging	Het
Mkx	T	A	18: 6,937,192	D284V	probably benign	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Otos	A	C	1: 92,645,351	L14R	probably damaging	Het
Plch2	C	T	4: 154,989,799	V765M	probably damaging	Het
Ppp4r3b	A	T	11: 29,173,358	Q18L	probably benign	Het
Psme4	T	A	11: 30,807,687		probably null	Het
Pwp1	G	A	10: 85,879,309	D220N	probably damaging	Het
Rel	G	A	11: 23,757,010	T64I	probably damaging	Het
Snai2	T	A	16: 14,708,247	M254K	possibly damaging	Het
Sntb2	A	G	8: 107,001,577	T386A	probably damaging	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tex22	A	G	12: 113,088,523	N67S	possibly damaging	Het
Trank1	T	G	9: 111,347,469	S270A	probably benign	Het
Ttc30a2	A	T	2: 75,976,332	V612D	probably benign	Het
Vcp	T	C	4: 42,988,728	T249A	possibly damaging	Het
Vmn1r167	A	G	7: 23,505,123	F156S	probably benign	Het
Vrk2	G	A	11: 26,535,522		probably benign	Het
Wdfy4	T	C	14: 33,140,612	E601G	probably damaging	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp638	A	G	6: 83,929,041	N63D	probably damaging	Het

Other mutations in Fry

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Fry	APN	5	150340404	nonsense	probably null
IGL00328:Fry	APN	5	150340404	nonsense	probably null
IGL00841:Fry	APN	5	150422724	missense	probably benign
IGL00938:Fry	APN	5	150370180	missense	probably damaging	1.00
IGL01015:Fry	APN	5	150422787	missense	probably benign	0.18
IGL01401:Fry	APN	5	150438788	missense	probably benign
IGL01616:Fry	APN	5	150399599	missense	probably damaging	1.00
IGL01616:Fry	APN	5	150438811	splice site	probably null
IGL01748:Fry	APN	5	150345651	splice site	probably benign
IGL01965:Fry	APN	5	150381621	missense	probably damaging	1.00
IGL02030:Fry	APN	5	150471618	splice site	probably benign
IGL02079:Fry	APN	5	150399624	missense	probably damaging	0.97
IGL02087:Fry	APN	5	150403594	missense	probably benign	0.23
IGL02113:Fry	APN	5	150399605	missense	probably benign
IGL02209:Fry	APN	5	150437026	missense	probably benign	0.00
IGL02250:Fry	APN	5	150403434	splice site	probably benign
IGL02265:Fry	APN	5	150437153	missense	probably damaging	1.00
IGL02486:Fry	APN	5	150491177	missense	probably damaging	0.99
IGL02552:Fry	APN	5	150380910	missense	probably damaging	1.00
IGL02881:Fry	APN	5	150359051	missense	probably damaging	0.99
IGL03008:Fry	APN	5	150345556	missense	possibly damaging	0.82
IGL03140:Fry	APN	5	150495701	missense	probably damaging	0.98
IGL03171:Fry	APN	5	150380809	missense	probably damaging	1.00
IGL03389:Fry	APN	5	150394231	missense	probably damaging	1.00
IGL03404:Fry	APN	5	150326168	missense	probably damaging	1.00
Brook	UTSW	5	150326132	missense	probably damaging	1.00
haydn	UTSW	5	150418464	missense	possibly damaging	0.94
miracle	UTSW	5	150437159	missense	probably damaging	0.99
quickening	UTSW	5	150434776	missense	probably damaging	1.00
seasons	UTSW	5	150466437	missense	probably benign	0.06
Vivaldi	UTSW	5	150394138	missense	possibly damaging	0.80
R0023:Fry	UTSW	5	150451098	missense	possibly damaging	0.78
R0024:Fry	UTSW	5	150380803	missense	probably benign	0.03
R0030:Fry	UTSW	5	150372569	nonsense	probably null
R0053:Fry	UTSW	5	150461377	splice site	probably benign
R0089:Fry	UTSW	5	150340427	missense	possibly damaging	0.91
R0212:Fry	UTSW	5	150496397	missense	probably damaging	0.99
R0241:Fry	UTSW	5	150260346	intron	probably benign
R0265:Fry	UTSW	5	150434776	missense	probably damaging	1.00
R0317:Fry	UTSW	5	150471468	missense	probably damaging	1.00
R0532:Fry	UTSW	5	150433707	unclassified	probably benign
R0532:Fry	UTSW	5	150478761	splice site	probably benign
R0599:Fry	UTSW	5	150437159	missense	probably damaging	0.99
R0631:Fry	UTSW	5	150496352	missense	possibly damaging	0.82
R0723:Fry	UTSW	5	150496360	missense	probably damaging	1.00
R0790:Fry	UTSW	5	150466437	missense	probably benign	0.06
R0928:Fry	UTSW	5	150437084	missense	probably damaging	1.00
R1104:Fry	UTSW	5	150496289	missense	probably damaging	1.00
R1144:Fry	UTSW	5	150418464	missense	possibly damaging	0.94
R1172:Fry	UTSW	5	150481494	nonsense	probably null
R1312:Fry	UTSW	5	150403432	splice site	probably benign
R1347:Fry	UTSW	5	150495818	missense	probably damaging	1.00
R1347:Fry	UTSW	5	150495818	missense	probably damaging	1.00
R1437:Fry	UTSW	5	150310425	missense	possibly damaging	0.92
R1458:Fry	UTSW	5	150380859	missense	probably damaging	1.00
R1542:Fry	UTSW	5	150404966	missense	probably benign	0.13
R1692:Fry	UTSW	5	150370227	missense	probably damaging	1.00
R1826:Fry	UTSW	5	150436709	missense	possibly damaging	0.82
R1874:Fry	UTSW	5	150345921	missense	probably damaging	1.00
R1875:Fry	UTSW	5	150326132	missense	probably damaging	1.00
R1881:Fry	UTSW	5	150478046	missense	probably damaging	0.97
R1884:Fry	UTSW	5	150403520	missense	probably benign	0.00
R1929:Fry	UTSW	5	150400924	missense	probably null	0.02
R2066:Fry	UTSW	5	150370119	splice site	probably benign
R2270:Fry	UTSW	5	150400924	missense	probably null	0.02
R2356:Fry	UTSW	5	150471432	missense	probably benign
R3720:Fry	UTSW	5	150454572	missense	probably damaging	1.00
R3773:Fry	UTSW	5	150398198	missense	probably damaging	0.96
R3824:Fry	UTSW	5	150496419	missense	possibly damaging	0.94
R3902:Fry	UTSW	5	150345927	missense	probably damaging	1.00
R3923:Fry	UTSW	5	150413349	missense	probably benign
R4250:Fry	UTSW	5	150310360	missense	probably damaging	0.99
R4332:Fry	UTSW	5	150381663	missense	probably damaging	1.00
R4495:Fry	UTSW	5	150310463	missense	probably damaging	1.00
R4610:Fry	UTSW	5	150386104	missense	probably damaging	1.00
R4682:Fry	UTSW	5	150422754	missense	probably damaging	1.00
R4732:Fry	UTSW	5	150386007	missense
R4733:Fry	UTSW	5	150386007	missense
R4755:Fry	UTSW	5	150398254	missense	probably damaging	0.99
R4788:Fry	UTSW	5	150399636	missense	probably benign	0.00
R4803:Fry	UTSW	5	150399533	missense	probably benign	0.31
R4858:Fry	UTSW	5	150401643	missense	possibly damaging	0.78
R4872:Fry	UTSW	5	150394239	critical splice donor site	probably null
R4902:Fry	UTSW	5	150495703	missense	probably benign	0.43
R4915:Fry	UTSW	5	150478863	missense	probably benign	0.30
R4938:Fry	UTSW	5	150477989	missense	probably damaging	1.00
R4983:Fry	UTSW	5	150398254	missense	probably damaging	1.00
R5004:Fry	UTSW	5	150433604	missense	probably benign	0.16
R5040:Fry	UTSW	5	150388854	missense	probably damaging	0.99
R5145:Fry	UTSW	5	150370224	missense	probably damaging	0.98
R5170:Fry	UTSW	5	150429854	missense	probably benign	0.03
R5233:Fry	UTSW	5	150469720	missense	possibly damaging	0.71
R5428:Fry	UTSW	5	150405359	missense	possibly damaging	0.89
R5468:Fry	UTSW	5	150399588	missense	probably benign	0.44
R5481:Fry	UTSW	5	150260319	missense	probably benign	0.01
R5494:Fry	UTSW	5	150390667	missense	probably damaging	1.00
R5538:Fry	UTSW	5	150495848	missense	probably damaging	1.00
R5638:Fry	UTSW	5	150359081	missense	possibly damaging	0.46
R5645:Fry	UTSW	5	150380867	missense	probably damaging	1.00
R5716:Fry	UTSW	5	150370221	nonsense	probably null
R5812:Fry	UTSW	5	150399671	missense	probably damaging	0.99
R5813:Fry	UTSW	5	150399671	missense	probably damaging	0.99
R5873:Fry	UTSW	5	150378885	missense	probably damaging	1.00
R5933:Fry	UTSW	5	150390800	intron	probably benign
R6037:Fry	UTSW	5	150428179	missense	probably benign	0.03
R6037:Fry	UTSW	5	150428179	missense	probably benign	0.03
R6158:Fry	UTSW	5	150454572	missense	probably damaging	1.00
R6178:Fry	UTSW	5	150454522	missense	probably damaging	1.00
R6481:Fry	UTSW	5	150386014	missense	probably damaging	1.00
R6562:Fry	UTSW	5	150326149	missense	probably damaging	1.00
R6676:Fry	UTSW	5	150380922	missense	probably benign	0.22
R6717:Fry	UTSW	5	150496312	missense	probably benign	0.00
R6828:Fry	UTSW	5	150466446	splice site	probably null
R6874:Fry	UTSW	5	150437303	missense	probably benign	0.00
R6930:Fry	UTSW	5	150428230	missense	probably benign	0.00
R6963:Fry	UTSW	5	150457844	missense	probably benign	0.17
R6965:Fry	UTSW	5	150416220	missense	possibly damaging	0.79
R7051:Fry	UTSW	5	150395169	missense	possibly damaging	0.93
R7085:Fry	UTSW	5	150438749	missense	probably benign	0.02
R7108:Fry	UTSW	5	150395786	missense	probably damaging	1.00
R7108:Fry	UTSW	5	150491090	missense
R7115:Fry	UTSW	5	150386067	missense	probably damaging	1.00
R7116:Fry	UTSW	5	150395869	critical splice donor site	probably null
R7197:Fry	UTSW	5	150469767	missense
R7256:Fry	UTSW	5	150466786	missense
R7318:Fry	UTSW	5	150436993	missense	probably damaging	0.98
R7323:Fry	UTSW	5	150496349	missense
R7358:Fry	UTSW	5	150416323	missense	probably benign
R7361:Fry	UTSW	5	150436847	missense	possibly damaging	0.92
R7395:Fry	UTSW	5	150380883	missense	possibly damaging	0.82
R7487:Fry	UTSW	5	150414574	missense	possibly damaging	0.79
R7491:Fry	UTSW	5	150466326	missense
R7574:Fry	UTSW	5	150380894	missense	probably benign	0.00
R7582:Fry	UTSW	5	150496382	missense
R7586:Fry	UTSW	5	150426218	missense	probably damaging	1.00
R7650:Fry	UTSW	5	150413418	missense	probably damaging	1.00
R7699:Fry	UTSW	5	150405327	missense	probably damaging	0.98
R7700:Fry	UTSW	5	150405327	missense	probably damaging	0.98
R7972:Fry	UTSW	5	150310396	missense	probably benign	0.05
R8058:Fry	UTSW	5	150495767	missense
R8070:Fry	UTSW	5	150478007	missense
R8159:Fry	UTSW	5	150399533	missense	probably benign	0.31
R8202:Fry	UTSW	5	150431737	missense	probably damaging	1.00
R8261:Fry	UTSW	5	150445907	missense	probably damaging	1.00
R8279:Fry	UTSW	5	150496261	missense
R8338:Fry	UTSW	5	150359051	missense	probably damaging	0.99
R8370:Fry	UTSW	5	150395819	missense	probably damaging	1.00
R8673:Fry	UTSW	5	150395111	missense	possibly damaging	0.91
R8786:Fry	UTSW	5	150394036	missense	probably benign	0.00
R8815:Fry	UTSW	5	150394138	missense	possibly damaging	0.80
R8847:Fry	UTSW	5	150386007	missense
R9023:Fry	UTSW	5	150437303	missense	probably benign	0.00
R9025:Fry	UTSW	5	150295808	intron	probably benign
R9125:Fry	UTSW	5	150346060	missense	probably damaging	0.97
R9172:Fry	UTSW	5	150413328	missense	probably benign
R9262:Fry	UTSW	5	150381644	missense	probably damaging	1.00
R9263:Fry	UTSW	5	150399263	missense	probably damaging	1.00
R9293:Fry	UTSW	5	150495832	missense
R9368:Fry	UTSW	5	150477938	missense
R9401:Fry	UTSW	5	150378938	missense	probably damaging	1.00
R9402:Fry	UTSW	5	150433696	missense	possibly damaging	0.91
R9402:Fry	UTSW	5	150436853	missense	probably damaging	1.00
R9420:Fry	UTSW	5	150433529	missense	possibly damaging	0.72
Z1177:Fry	UTSW	5	150310437	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GCAGATACATAAGCCAGGCCCTTC -3'
(R):5'- TACCTGTTTCCGCACACAGTCG -3'

Sequencing Primer
(F):5'- AGCAGGCAATGTTACCTTCTGAG -3'
(R):5'- TCCGCACACAGTCGCTATG -3'

Posted On

2013-09-30