Incidental Mutation 'R0766:Zfp638'
List |< first << previous [record 37 of 37]
ID69496
Institutional Source Beutler Lab
Gene Symbol Zfp638
Ensembl Gene ENSMUSG00000030016
Gene Namezinc finger protein 638
SynonymsNp220, Zfml
MMRRC Submission 038946-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.823) question?
Stock #R0766 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83867109-83989550 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83929041 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 63 (N63D)
Ref Sequence ENSEMBL: ENSMUSP00000144989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032088] [ENSMUST00000113835] [ENSMUST00000113836] [ENSMUST00000203273] [ENSMUST00000203324] [ENSMUST00000203455] [ENSMUST00000203891] [ENSMUST00000204202] [ENSMUST00000204415] [ENSMUST00000204751]
Predicted Effect probably damaging
Transcript: ENSMUST00000032088
AA Change: N63D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032088
Gene: ENSMUSG00000030016
AA Change: N63D

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113835
AA Change: N63D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109466
Gene: ENSMUSG00000030016
AA Change: N63D

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 880 949 9.04e-3 SMART
Blast:RRM_2 984 1052 2e-25 BLAST
low complexity region 1095 1109 N/A INTRINSIC
ZnF_U1 1218 1252 2.84e-8 SMART
ZnF_C2H2 1221 1245 2.14e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113836
AA Change: N63D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109467
Gene: ENSMUSG00000030016
AA Change: N63D

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1222 1256 2.84e-8 SMART
ZnF_C2H2 1225 1249 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203273
Predicted Effect probably damaging
Transcript: ENSMUST00000203324
AA Change: N63D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145124
Gene: ENSMUSG00000030016
AA Change: N63D

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1220 1254 1.7e-10 SMART
ZnF_C2H2 1223 1247 8.9e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203455
AA Change: N63D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145047
Gene: ENSMUSG00000030016
AA Change: N63D

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
internal_repeat_1 819 891 3.29e-10 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203808
Predicted Effect probably damaging
Transcript: ENSMUST00000203891
AA Change: N63D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144939
Gene: ENSMUSG00000030016
AA Change: N63D

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1186 1220 1.7e-10 SMART
ZnF_C2H2 1189 1213 8.9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204110
Predicted Effect probably damaging
Transcript: ENSMUST00000204202
AA Change: N63D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145170
Gene: ENSMUSG00000030016
AA Change: N63D

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204415
AA Change: N159D

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145513
Gene: ENSMUSG00000030016
AA Change: N159D

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 112 131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204580
Predicted Effect probably damaging
Transcript: ENSMUST00000204751
AA Change: N63D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144989
Gene: ENSMUSG00000030016
AA Change: N63D

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleoplasmic protein. It binds cytidine-rich sequences in double-stranded DNA. This protein has three types of domains: MH1, MH2 (repeated three times) and MH3. It is associated with packaging, transferring, or processing transcripts. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A T 4: 103,270,797 F44I probably damaging Het
A2m T C 6: 121,676,890 probably benign Het
Card14 T C 11: 119,324,176 S241P probably damaging Het
Cdh15 G A 8: 122,861,449 probably benign Het
Dnah5 A C 15: 28,448,487 K4232T probably null Het
Eml6 A G 11: 29,831,219 probably benign Het
Esd T C 14: 74,742,121 S122P probably damaging Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Herc1 C T 9: 66,504,840 P4781S probably damaging Het
Iqch G A 9: 63,482,683 S738L probably benign Het
Itih2 T A 2: 10,097,924 T800S probably benign Het
Itpr1 A G 6: 108,410,900 E1533G probably damaging Het
Klrg1 T C 6: 122,279,663 M55V probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Otos A C 1: 92,645,351 L14R probably damaging Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rel G A 11: 23,757,010 T64I probably damaging Het
Snai2 T A 16: 14,708,247 M254K possibly damaging Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tex22 A G 12: 113,088,523 N67S possibly damaging Het
Trank1 T G 9: 111,347,469 S270A probably benign Het
Ttc30a2 A T 2: 75,976,332 V612D probably benign Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r167 A G 7: 23,505,123 F156S probably benign Het
Vrk2 G A 11: 26,535,522 probably benign Het
Wdfy4 T C 14: 33,140,612 E601G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Zfp638
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Zfp638 APN 6 83979718 missense probably damaging 1.00
IGL00514:Zfp638 APN 6 83956698 missense probably damaging 1.00
IGL00705:Zfp638 APN 6 83977130 missense probably damaging 1.00
IGL00785:Zfp638 APN 6 83929164 missense probably damaging 1.00
IGL01068:Zfp638 APN 6 83934994 missense probably damaging 1.00
IGL01084:Zfp638 APN 6 83944798 missense probably benign 0.01
IGL01570:Zfp638 APN 6 83947847 missense probably damaging 1.00
IGL01758:Zfp638 APN 6 83979526 missense probably damaging 0.96
IGL02345:Zfp638 APN 6 83984875 missense probably damaging 1.00
IGL02939:Zfp638 APN 6 83969232 missense probably damaging 0.98
IGL03007:Zfp638 APN 6 83984884 missense probably damaging 1.00
IGL03118:Zfp638 APN 6 83935018 splice site probably benign
IGL03135:Zfp638 APN 6 83942875 missense probably damaging 1.00
IGL03264:Zfp638 APN 6 83946247 missense probably benign 0.04
R0190:Zfp638 UTSW 6 83928964 missense probably damaging 1.00
R0200:Zfp638 UTSW 6 83967354 missense probably damaging 1.00
R0801:Zfp638 UTSW 6 83972238 unclassified probably benign
R0938:Zfp638 UTSW 6 83984041 missense probably benign 0.16
R1312:Zfp638 UTSW 6 83929041 missense probably damaging 1.00
R1458:Zfp638 UTSW 6 83944656 missense probably damaging 1.00
R1584:Zfp638 UTSW 6 83978065 splice site probably null
R1634:Zfp638 UTSW 6 83979912 splice site probably null
R1651:Zfp638 UTSW 6 83954737 missense probably benign 0.00
R2079:Zfp638 UTSW 6 83953389 critical splice donor site probably null
R2134:Zfp638 UTSW 6 83928982 missense probably damaging 1.00
R2142:Zfp638 UTSW 6 83986596 missense probably damaging 1.00
R2201:Zfp638 UTSW 6 83929518 missense probably damaging 1.00
R2422:Zfp638 UTSW 6 83966439 splice site probably benign
R4353:Zfp638 UTSW 6 83984059 missense probably damaging 0.97
R4681:Zfp638 UTSW 6 83981737 missense possibly damaging 0.50
R4716:Zfp638 UTSW 6 83979562 nonsense probably null
R4807:Zfp638 UTSW 6 83943058 missense probably damaging 1.00
R4850:Zfp638 UTSW 6 83979475 missense possibly damaging 0.92
R5079:Zfp638 UTSW 6 83929456 missense probably benign 0.03
R5236:Zfp638 UTSW 6 83976575 nonsense probably null
R5323:Zfp638 UTSW 6 83962094 missense probably damaging 0.96
R5426:Zfp638 UTSW 6 83976414 missense probably damaging 1.00
R5557:Zfp638 UTSW 6 83967363 missense probably damaging 1.00
R5570:Zfp638 UTSW 6 83979188 missense probably damaging 1.00
R5614:Zfp638 UTSW 6 83929641 missense probably damaging 1.00
R5662:Zfp638 UTSW 6 83943129 missense probably damaging 0.97
R5685:Zfp638 UTSW 6 83929987 missense probably damaging 1.00
R5689:Zfp638 UTSW 6 83929072 missense probably damaging 1.00
R5783:Zfp638 UTSW 6 83944847 missense possibly damaging 0.92
R5856:Zfp638 UTSW 6 83977065 missense probably damaging 1.00
R6310:Zfp638 UTSW 6 83867230 missense possibly damaging 0.90
R6477:Zfp638 UTSW 6 83965578 missense probably damaging 1.00
R6557:Zfp638 UTSW 6 83930110 missense probably damaging 1.00
R7084:Zfp638 UTSW 6 83953126 missense possibly damaging 0.50
R7101:Zfp638 UTSW 6 83954726 missense probably benign 0.00
R7141:Zfp638 UTSW 6 83867199 missense unknown
R7368:Zfp638 UTSW 6 83929455 missense possibly damaging 0.60
R7402:Zfp638 UTSW 6 83928688 missense possibly damaging 0.92
R7455:Zfp638 UTSW 6 83930145 missense probably damaging 1.00
R7762:Zfp638 UTSW 6 83976272 missense probably damaging 1.00
R7773:Zfp638 UTSW 6 83979214 missense probably damaging 1.00
R8090:Zfp638 UTSW 6 83929819 missense probably damaging 0.99
R8154:Zfp638 UTSW 6 83977409 missense probably damaging 1.00
R8161:Zfp638 UTSW 6 83929731 missense possibly damaging 0.85
R8327:Zfp638 UTSW 6 83928697 missense probably damaging 0.99
R8384:Zfp638 UTSW 6 83979765 missense probably benign 0.28
Z1088:Zfp638 UTSW 6 83944811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGTAGCCATGTCGAGACCCAG -3'
(R):5'- TGAAGCACTCTCTTTTGTGTAGCGG -3'

Sequencing Primer
(F):5'- ATGTCGAGACCCAGGTTTAATCC -3'
(R):5'- AGGACTTTGCTCTGTAACCTG -3'
Posted On2013-09-30