Incidental Mutation 'R9150:Eml6'
ID 694976
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Name echinoderm microtubule associated protein like 6
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock # R9150 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 29743048-30026033 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 29805791 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 821 (V821E)
Ref Sequence ENSEMBL: ENSMUSP00000051080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902]
AlphaFold Q5SQM0
Predicted Effect probably benign
Transcript: ENSMUST00000058902
AA Change: V821E

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: V821E

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109452
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b CTCCGGTGAGTGCCTCATCC CTCC 5: 137,555,092 probably null Het
Ampd1 A T 3: 103,081,043 I101F possibly damaging Het
Arhgap11a A G 2: 113,843,269 V92A possibly damaging Het
Arih1 C A 9: 59,436,786 L189F possibly damaging Het
B4galt3 A G 1: 171,276,326 R379G probably benign Het
BC080695 A G 4: 143,571,961 Y158C probably benign Het
C130026I21Rik T A 1: 85,113,638 Q33L probably damaging Het
Capn12 A G 7: 28,890,953 N642D probably benign Het
Cdc42ep3 T C 17: 79,334,870 H207R probably benign Het
Dcps A T 9: 35,124,642 L316H probably damaging Het
Dmgdh A G 13: 93,688,595 Y142C probably damaging Het
Elmo2 A G 2: 165,298,687 V300A probably damaging Het
Fam181a A T 12: 103,315,880 N15Y probably damaging Het
Gm26657 G T 4: 56,740,835 E7* probably null Het
Gm8267 A T 14: 44,717,905 S220T probably benign Het
Gpld1 A T 13: 24,962,322 Y183F probably damaging Het
Gpr158 G A 2: 21,826,440 G784R probably benign Het
Grm2 A G 9: 106,647,458 L215P Het
Gtpbp1 A G 15: 79,707,964 D252G probably damaging Het
Heatr5b A G 17: 78,796,019 V1135A probably benign Het
Lrrc8e A C 8: 4,236,030 K752Q probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mapre2 A G 18: 23,858,151 T201A probably benign Het
Mcm9 A T 10: 53,626,014 N85K Het
Mdga1 T C 17: 29,838,446 T92A probably damaging Het
Mgea5 A T 19: 45,782,982 V50E probably benign Het
Mrvi1 T C 7: 110,898,998 T397A probably benign Het
Nemf A C 12: 69,341,046 D421E probably benign Het
Olfr1032 A T 2: 86,008,282 K169* probably null Het
Olfr1055 A T 2: 86,346,992 M258K probably damaging Het
Olfr177 G T 16: 58,872,642 C169* probably null Het
Olfr309 G C 7: 86,306,734 F126L probably damaging Het
Pcdhga5 A C 18: 37,694,880 N127T probably damaging Het
Phyhipl A T 10: 70,569,057 V107E probably damaging Het
Pkd1l1 G A 11: 8,836,256 R2383C Het
Ppp1r16a G A 15: 76,690,854 probably benign Het
Rnf41 T C 10: 128,436,530 V142A Het
Sgcd C T 11: 46,979,343 V264I probably damaging Het
Six2 A G 17: 85,685,335 S247P probably benign Het
Slc17a7 T G 7: 45,170,743 Y241D probably damaging Het
Slc30a5 T A 13: 100,803,407 K724* probably null Het
Slitrk1 T A 14: 108,911,669 I537F possibly damaging Het
Spen C T 4: 141,517,157 R189Q unknown Het
Srd5a3 T A 5: 76,149,768 L139Q probably damaging Het
Tgfbrap1 A T 1: 43,075,825 Y38* probably null Het
Tln2 A T 9: 67,221,496 M1437K probably damaging Het
Tmem87b T C 2: 128,845,481 I467T probably damaging Het
Tnfrsf21 T A 17: 43,087,800 I599N probably damaging Het
Trmt112 T A 19: 6,910,252 L23Q probably damaging Het
Tsc22d1 T A 14: 76,416,616 N178K probably damaging Het
Ttc23 A G 7: 67,726,102 Y476C probably damaging Het
Twf1 A T 15: 94,586,393 W83R probably damaging Het
Vmn2r14 T A 5: 109,219,917 H403L probably damaging Het
Wiz A T 17: 32,367,835 I167N probably benign Het
Zdhhc22 G A 12: 86,988,418 P87S probably benign Het
Zfp618 C T 4: 63,121,366 Q401* probably null Het
Zfp715 T A 7: 43,299,289 I416F possibly damaging Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29850816 critical splice donor site probably null
IGL01407:Eml6 APN 11 29755021 nonsense probably null
IGL01434:Eml6 APN 11 29819090 missense probably damaging 1.00
IGL01578:Eml6 APN 11 29850870 missense probably benign 0.02
IGL01780:Eml6 APN 11 29805175 missense probably benign 0.17
IGL01821:Eml6 APN 11 29821699 missense probably benign 0.00
IGL01837:Eml6 APN 11 29777055 missense probably benign 0.00
IGL01904:Eml6 APN 11 29838613 nonsense probably null
IGL01972:Eml6 APN 11 29838451 missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29759066 missense probably benign 0.13
IGL02192:Eml6 APN 11 29805743 missense probably benign 0.00
IGL02377:Eml6 APN 11 29777282 missense probably damaging 0.98
IGL02584:Eml6 APN 11 29749387 missense probably damaging 0.99
IGL02587:Eml6 APN 11 29784236 missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29849016 missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29880700 missense probably benign 0.10
IGL02880:Eml6 APN 11 29749959 missense probably benign 0.03
IGL03289:Eml6 APN 11 29795328 missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29764083 missense probably benign 0.18
IGL03386:Eml6 APN 11 29749934 missense probably benign
IGL03407:Eml6 APN 11 29906330 missense probably damaging 1.00
PIT4453001:Eml6 UTSW 11 29802489 missense probably damaging 1.00
R0125:Eml6 UTSW 11 29882088 missense probably benign 0.19
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0271:Eml6 UTSW 11 29848949 missense possibly damaging 0.48
R0304:Eml6 UTSW 11 29777441 missense probably benign 0.00
R0415:Eml6 UTSW 11 29749392 missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29893213 missense probably benign 0.01
R0538:Eml6 UTSW 11 29760010 splice site probably benign
R0671:Eml6 UTSW 11 29805065 missense probably benign 0.00
R0766:Eml6 UTSW 11 29831219 splice site probably benign
R0800:Eml6 UTSW 11 29749877 missense probably benign 0.08
R0841:Eml6 UTSW 11 29777430 missense probably benign 0.41
R0879:Eml6 UTSW 11 29850816 critical splice donor site probably null
R1061:Eml6 UTSW 11 29777267 missense probably damaging 1.00
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1172:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29755044 missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29831088 splice site probably benign
R1312:Eml6 UTSW 11 29831219 splice site probably benign
R1355:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1370:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1457:Eml6 UTSW 11 30024459 missense probably damaging 1.00
R1486:Eml6 UTSW 11 29805114 missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29818374 missense probably damaging 1.00
R1532:Eml6 UTSW 11 29792256 splice site probably null
R1642:Eml6 UTSW 11 29777001 critical splice donor site probably null
R1682:Eml6 UTSW 11 29759065 missense probably benign 0.13
R1687:Eml6 UTSW 11 29833187 missense probably damaging 1.00
R1699:Eml6 UTSW 11 29746282 nonsense probably null
R1796:Eml6 UTSW 11 29881975 missense probably benign 0.19
R1797:Eml6 UTSW 11 29882041 missense probably benign 0.09
R1837:Eml6 UTSW 11 29749802 splice site probably null
R1874:Eml6 UTSW 11 29831136 missense probably damaging 0.99
R1967:Eml6 UTSW 11 30024545 missense probably damaging 1.00
R1969:Eml6 UTSW 11 29833075 missense probably benign
R2007:Eml6 UTSW 11 29848814 critical splice donor site probably null
R2012:Eml6 UTSW 11 29831128 missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29850935 missense probably benign 0.01
R2217:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2218:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2403:Eml6 UTSW 11 29802434 missense probably benign 0.05
R2520:Eml6 UTSW 11 29791993 missense probably damaging 1.00
R2937:Eml6 UTSW 11 29833049 splice site probably benign
R2938:Eml6 UTSW 11 29833049 splice site probably benign
R3085:Eml6 UTSW 11 29809332 missense probably damaging 0.96
R3236:Eml6 UTSW 11 29831097 critical splice donor site probably null
R3738:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3739:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3752:Eml6 UTSW 11 29809360 missense probably benign 0.06
R3854:Eml6 UTSW 11 29749905 missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29803167 missense probably damaging 0.98
R4034:Eml6 UTSW 11 29803137 missense probably benign 0.20
R4049:Eml6 UTSW 11 29838577 missense probably damaging 1.00
R4108:Eml6 UTSW 11 29805136 missense probably damaging 0.98
R4657:Eml6 UTSW 11 29805108 missense possibly damaging 0.77
R4662:Eml6 UTSW 11 29777390 missense probably damaging 1.00
R4665:Eml6 UTSW 11 29819007 nonsense probably null
R4721:Eml6 UTSW 11 29838525 missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29833204 missense probably damaging 1.00
R4766:Eml6 UTSW 11 29805757 missense probably benign 0.22
R4810:Eml6 UTSW 11 29755011 missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29777052 nonsense probably null
R5035:Eml6 UTSW 11 29854187 missense probably benign 0.00
R5064:Eml6 UTSW 11 29749300 missense probably benign 0.12
R5103:Eml6 UTSW 11 29850905 missense possibly damaging 0.65
R5121:Eml6 UTSW 11 29744606 missense probably benign 0.03
R5161:Eml6 UTSW 11 30024467 missense probably damaging 0.99
R5211:Eml6 UTSW 11 29854145 missense probably benign 0.02
R5268:Eml6 UTSW 11 29803108 missense probably benign 0.15
R5390:Eml6 UTSW 11 29760096 missense probably damaging 1.00
R5529:Eml6 UTSW 11 29764126 missense probably benign 0.04
R6239:Eml6 UTSW 11 29749275 missense probably damaging 1.00
R6326:Eml6 UTSW 11 29819066 missense probably damaging 1.00
R6395:Eml6 UTSW 11 29809321 missense probably benign 0.00
R6476:Eml6 UTSW 11 29791971 critical splice donor site probably null
R6483:Eml6 UTSW 11 29749875 missense probably benign 0.00
R6701:Eml6 UTSW 11 29785748 missense probably damaging 0.98
R6753:Eml6 UTSW 11 29754987 missense probably damaging 1.00
R6809:Eml6 UTSW 11 29803161 missense probably benign 0.23
R6847:Eml6 UTSW 11 29818447 missense probably benign 0.00
R6855:Eml6 UTSW 11 29751381 splice site probably null
R7168:Eml6 UTSW 11 29838529 missense probably benign 0.01
R7175:Eml6 UTSW 11 29784231 missense probably benign 0.00
R7305:Eml6 UTSW 11 29777258 missense probably benign 0.01
R7615:Eml6 UTSW 11 29802501 missense possibly damaging 0.49
R7692:Eml6 UTSW 11 29753085 missense probably damaging 0.98
R7980:Eml6 UTSW 11 29833205 missense probably damaging 1.00
R8026:Eml6 UTSW 11 29749973 missense possibly damaging 0.63
R8046:Eml6 UTSW 11 29758981 missense probably damaging 0.99
R8049:Eml6 UTSW 11 29893201 missense possibly damaging 0.95
R8114:Eml6 UTSW 11 29754910 missense probably damaging 1.00
R8425:Eml6 UTSW 11 29755008 missense probably benign 0.00
R8799:Eml6 UTSW 11 29758981 missense probably benign 0.11
R8945:Eml6 UTSW 11 29753110 missense probably damaging 0.98
R8977:Eml6 UTSW 11 29784182 missense possibly damaging 0.59
R8986:Eml6 UTSW 11 29805181 missense possibly damaging 0.92
R9088:Eml6 UTSW 11 29818424 missense probably damaging 0.96
R9209:Eml6 UTSW 11 29831175 missense probably damaging 1.00
R9288:Eml6 UTSW 11 29838641 critical splice acceptor site probably null
R9467:Eml6 UTSW 11 29819076 missense probably damaging 0.99
RF037:Eml6 UTSW 11 29752549 critical splice acceptor site probably benign
RF039:Eml6 UTSW 11 29752551 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AGTCCAATGCAAAGCTGGG -3'
(R):5'- CCGCCCCAGTGCTATTATTTTATAG -3'

Sequencing Primer
(F):5'- CTGGGAGAGTATATTAACCAGGCAC -3'
(R):5'- GCTTACTTATCCTATTAGATACCCT -3'
Posted On 2022-01-20