Incidental Mutation 'R0766:Klrg1'
ID69499
Institutional Source Beutler Lab
Gene Symbol Klrg1
Ensembl Gene ENSMUSG00000030114
Gene Namekiller cell lectin-like receptor subfamily G, member 1
Synonyms2F1-Ag
MMRRC Submission 038946-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0766 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location122270596-122282882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122279663 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 55 (M55V)
Ref Sequence ENSEMBL: ENSMUSP00000032207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032207]
PDB Structure
Structure of NK cell receptor KLRG1 bound to E-cadherin [X-RAY DIFFRACTION]
Structure of NK cell receptor KLRG1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000032207
AA Change: M55V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000032207
Gene: ENSMUSG00000030114
AA Change: M55V

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
CLECT 75 184 1.13e-18 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. The protein encoded by this gene belongs to the killer cell lectin-like receptor (KLR) family, which is a group of transmembrane proteins preferentially expressed in NK cells. Studies in mice suggested that the expression of this gene may be regulated by MHC class I molecules. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a null allele have no abnormal phenoptype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A T 4: 103,270,797 F44I probably damaging Het
A2m T C 6: 121,676,890 probably benign Het
Card14 T C 11: 119,324,176 S241P probably damaging Het
Cdh15 G A 8: 122,861,449 probably benign Het
Dnah5 A C 15: 28,448,487 K4232T probably null Het
Eml6 A G 11: 29,831,219 probably benign Het
Esd T C 14: 74,742,121 S122P probably damaging Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Herc1 C T 9: 66,504,840 P4781S probably damaging Het
Iqch G A 9: 63,482,683 S738L probably benign Het
Itih2 T A 2: 10,097,924 T800S probably benign Het
Itpr1 A G 6: 108,410,900 E1533G probably damaging Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Otos A C 1: 92,645,351 L14R probably damaging Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rel G A 11: 23,757,010 T64I probably damaging Het
Snai2 T A 16: 14,708,247 M254K possibly damaging Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tex22 A G 12: 113,088,523 N67S possibly damaging Het
Trank1 T G 9: 111,347,469 S270A probably benign Het
Ttc30a2 A T 2: 75,976,332 V612D probably benign Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r167 A G 7: 23,505,123 F156S probably benign Het
Vrk2 G A 11: 26,535,522 probably benign Het
Wdfy4 T C 14: 33,140,612 E601G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp638 A G 6: 83,929,041 N63D probably damaging Het
Other mutations in Klrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Klrg1 APN 6 122282752 missense probably benign 0.00
R1297:Klrg1 UTSW 6 122273579 missense probably benign 0.12
R1974:Klrg1 UTSW 6 122282762 missense possibly damaging 0.74
R2034:Klrg1 UTSW 6 122279637 critical splice donor site probably null
R4823:Klrg1 UTSW 6 122273533 splice site probably null
R4995:Klrg1 UTSW 6 122278275 missense probably benign 0.00
R5029:Klrg1 UTSW 6 122282735 missense probably benign
R5225:Klrg1 UTSW 6 122271372 makesense probably null
R6389:Klrg1 UTSW 6 122271472 missense probably damaging 0.96
R6482:Klrg1 UTSW 6 122271453 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGACCAGAGAAATCCCAACTTCCTG -3'
(R):5'- GTTCCCTTTAACTGGAGAGCGAGTG -3'

Sequencing Primer
(F):5'- GCCTGAATTCGAAGTGGAGA -3'
(R):5'- AGTGCTCTCCCTAACCAGG -3'
Posted On2013-09-30