Incidental Mutation 'R0766:Vmn1r167'
ID69500
Institutional Source Beutler Lab
Gene Symbol Vmn1r167
Ensembl Gene ENSMUSG00000090715
Gene Namevomeronasal 1 receptor 167
SynonymsGm6279
MMRRC Submission 038946-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R0766 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location23503646-23507206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23505123 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 156 (F156S)
Ref Sequence ENSEMBL: ENSMUSP00000153774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164527] [ENSMUST00000227713]
Predicted Effect probably benign
Transcript: ENSMUST00000164527
AA Change: F156S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000129193
Gene: ENSMUSG00000090715
AA Change: F156S

DomainStartEndE-ValueType
Pfam:TAS2R 19 307 1.5e-13 PFAM
Pfam:7tm_1 41 299 3.8e-6 PFAM
Pfam:V1R 52 306 2.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227713
AA Change: F156S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A T 4: 103,270,797 F44I probably damaging Het
A2m T C 6: 121,676,890 probably benign Het
Card14 T C 11: 119,324,176 S241P probably damaging Het
Cdh15 G A 8: 122,861,449 probably benign Het
Dnah5 A C 15: 28,448,487 K4232T probably null Het
Eml6 A G 11: 29,831,219 probably benign Het
Esd T C 14: 74,742,121 S122P probably damaging Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Herc1 C T 9: 66,504,840 P4781S probably damaging Het
Iqch G A 9: 63,482,683 S738L probably benign Het
Itih2 T A 2: 10,097,924 T800S probably benign Het
Itpr1 A G 6: 108,410,900 E1533G probably damaging Het
Klrg1 T C 6: 122,279,663 M55V probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Otos A C 1: 92,645,351 L14R probably damaging Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rel G A 11: 23,757,010 T64I probably damaging Het
Snai2 T A 16: 14,708,247 M254K possibly damaging Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tex22 A G 12: 113,088,523 N67S possibly damaging Het
Trank1 T G 9: 111,347,469 S270A probably benign Het
Ttc30a2 A T 2: 75,976,332 V612D probably benign Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vrk2 G A 11: 26,535,522 probably benign Het
Wdfy4 T C 14: 33,140,612 E601G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp638 A G 6: 83,929,041 N63D probably damaging Het
Other mutations in Vmn1r167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Vmn1r167 APN 7 23505439 missense probably damaging 0.98
IGL02261:Vmn1r167 APN 7 23504836 missense probably benign 0.17
IGL02963:Vmn1r167 APN 7 23505550 missense possibly damaging 0.60
R0054:Vmn1r167 UTSW 7 23504909 missense possibly damaging 0.89
R0555:Vmn1r167 UTSW 7 23505087 missense probably damaging 1.00
R1312:Vmn1r167 UTSW 7 23505123 missense probably benign 0.01
R1464:Vmn1r167 UTSW 7 23505256 missense possibly damaging 0.62
R1464:Vmn1r167 UTSW 7 23505256 missense possibly damaging 0.62
R1532:Vmn1r167 UTSW 7 23504779 missense probably benign 0.01
R1937:Vmn1r167 UTSW 7 23505027 missense probably benign 0.25
R2162:Vmn1r167 UTSW 7 23504799 missense possibly damaging 0.91
R4639:Vmn1r167 UTSW 7 23505586 missense probably benign 0.00
R4661:Vmn1r167 UTSW 7 23504692 missense probably damaging 1.00
R4845:Vmn1r167 UTSW 7 23504733 missense probably benign 0.01
R4868:Vmn1r167 UTSW 7 23504736 missense probably benign
R4993:Vmn1r167 UTSW 7 23505228 missense probably damaging 1.00
R5693:Vmn1r167 UTSW 7 23505221 nonsense probably null
R6622:Vmn1r167 UTSW 7 23505589 start codon destroyed probably null
R7800:Vmn1r167 UTSW 7 23504644 makesense probably null
R8297:Vmn1r167 UTSW 7 23504790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGACACTGCTCCAGATGATGATG -3'
(R):5'- AGCCAACTTAGCTGTGGGCAATAC -3'

Sequencing Primer
(F):5'- GATGATGCTGATGAACACTCC -3'
(R):5'- CTGTGGGCAATACCTTGATTC -3'
Posted On2013-09-30