Incidental Mutation 'R0766:Iqch'
ID69504
Institutional Source Beutler Lab
Gene Symbol Iqch
Ensembl Gene ENSMUSG00000037801
Gene NameIQ motif containing H
Synonyms4921504K03Rik
MMRRC Submission 038946-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0766 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location63421455-63602493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63482683 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 738 (S738L)
Ref Sequence ENSEMBL: ENSMUSP00000128482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042322] [ENSMUST00000080527] [ENSMUST00000163624] [ENSMUST00000163982] [ENSMUST00000171243]
Predicted Effect probably benign
Transcript: ENSMUST00000042322
AA Change: S738L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000047953
Gene: ENSMUSG00000037801
AA Change: S738L

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080527
SMART Domains Protein: ENSMUSP00000079370
Gene: ENSMUSG00000037801

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126238
Predicted Effect probably benign
Transcript: ENSMUST00000163624
AA Change: S738L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128482
Gene: ENSMUSG00000037801
AA Change: S738L

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163982
AA Change: S738L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000126546
Gene: ENSMUSG00000037801
AA Change: S738L

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171243
AA Change: S699L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000131828
Gene: ENSMUSG00000037801
AA Change: S699L

DomainStartEndE-ValueType
low complexity region 218 228 N/A INTRINSIC
IQ 366 388 2.79e0 SMART
low complexity region 440 452 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191455
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A T 4: 103,270,797 F44I probably damaging Het
A2m T C 6: 121,676,890 probably benign Het
Card14 T C 11: 119,324,176 S241P probably damaging Het
Cdh15 G A 8: 122,861,449 probably benign Het
Dnah5 A C 15: 28,448,487 K4232T probably null Het
Eml6 A G 11: 29,831,219 probably benign Het
Esd T C 14: 74,742,121 S122P probably damaging Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Herc1 C T 9: 66,504,840 P4781S probably damaging Het
Itih2 T A 2: 10,097,924 T800S probably benign Het
Itpr1 A G 6: 108,410,900 E1533G probably damaging Het
Klrg1 T C 6: 122,279,663 M55V probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Otos A C 1: 92,645,351 L14R probably damaging Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rel G A 11: 23,757,010 T64I probably damaging Het
Snai2 T A 16: 14,708,247 M254K possibly damaging Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tex22 A G 12: 113,088,523 N67S possibly damaging Het
Trank1 T G 9: 111,347,469 S270A probably benign Het
Ttc30a2 A T 2: 75,976,332 V612D probably benign Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r167 A G 7: 23,505,123 F156S probably benign Het
Vrk2 G A 11: 26,535,522 probably benign Het
Wdfy4 T C 14: 33,140,612 E601G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp638 A G 6: 83,929,041 N63D probably damaging Het
Other mutations in Iqch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Iqch APN 9 63480654 missense probably damaging 0.96
IGL01472:Iqch APN 9 63547934 missense probably benign 0.02
IGL01553:Iqch APN 9 63500917 missense probably benign 0.00
IGL01611:Iqch APN 9 63496237 critical splice acceptor site probably null
IGL02608:Iqch APN 9 63421828 unclassified probably benign
IGL03060:Iqch APN 9 63524914 missense probably damaging 1.00
IGL03154:Iqch APN 9 63454682 missense probably damaging 0.97
I2288:Iqch UTSW 9 63500890 missense probably benign 0.01
R0002:Iqch UTSW 9 63594743 splice site probably benign
R0350:Iqch UTSW 9 63500876 missense probably benign 0.43
R0532:Iqch UTSW 9 63508232 splice site probably benign
R0629:Iqch UTSW 9 63425382 missense probably benign 0.22
R0710:Iqch UTSW 9 63525136 missense probably benign
R1797:Iqch UTSW 9 63588377 missense possibly damaging 0.58
R1856:Iqch UTSW 9 63534337 splice site probably null
R1954:Iqch UTSW 9 63548016 missense probably benign 0.00
R1955:Iqch UTSW 9 63548016 missense probably benign 0.00
R2184:Iqch UTSW 9 63525069 missense probably damaging 0.99
R2264:Iqch UTSW 9 63512299 missense probably benign 0.27
R4614:Iqch UTSW 9 63482581 missense probably benign
R4643:Iqch UTSW 9 63594802 missense probably benign 0.00
R4654:Iqch UTSW 9 63524913 missense probably damaging 0.99
R4665:Iqch UTSW 9 63445571 missense probably damaging 1.00
R5027:Iqch UTSW 9 63525012 missense possibly damaging 0.87
R5042:Iqch UTSW 9 63496234 missense possibly damaging 0.48
R5551:Iqch UTSW 9 63496253 intron probably null
R5829:Iqch UTSW 9 63425357 critical splice donor site probably null
R5878:Iqch UTSW 9 63547990 missense probably damaging 0.99
R6816:Iqch UTSW 9 63480759 missense probably benign 0.02
R6930:Iqch UTSW 9 63480574 missense possibly damaging 0.79
R7000:Iqch UTSW 9 63454610 missense probably benign
R7026:Iqch UTSW 9 63525139 nonsense probably null
R7066:Iqch UTSW 9 63524745 missense probably benign 0.24
R7111:Iqch UTSW 9 63512317 missense possibly damaging 0.79
R7129:Iqch UTSW 9 63421909 missense probably benign 0.09
R7177:Iqch UTSW 9 63421835 makesense probably null
R7252:Iqch UTSW 9 63512236 critical splice donor site probably null
R7485:Iqch UTSW 9 63508317 missense possibly damaging 0.47
R7541:Iqch UTSW 9 63445521 missense possibly damaging 0.95
X0066:Iqch UTSW 9 63429058 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAACGGCAGAAGCAGTTTCTACAC -3'
(R):5'- TGGGCTACTGATGACCAGCACAAG -3'

Sequencing Primer
(F):5'- CTGGCTTGACCCAGAACTAGAAG -3'
(R):5'- TGCCTTCTGGAGACAATATGC -3'
Posted On2013-09-30