Incidental Mutation 'R9151:Gprc6a'
ID 695042
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 068973-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9151 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 51490919-51507554 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 51497182 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 454 (T454P)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect possibly damaging
Transcript: ENSMUST00000020062
AA Change: T454P

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: T454P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218684
AA Change: T279P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000219286
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,188,908 (GRCm39) F850L probably benign Het
Adam1a A T 5: 121,657,411 (GRCm39) D627E probably damaging Het
Add2 C A 6: 86,081,459 (GRCm39) probably benign Het
Anpep T C 7: 79,491,785 (GRCm39) N72S probably benign Het
Aqp6 A G 15: 99,501,655 (GRCm39) T238A possibly damaging Het
Arhgef38 G T 3: 132,912,706 (GRCm39) T111K Het
Atg10 A G 13: 91,189,032 (GRCm39) Y93H probably damaging Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Cald1 A G 6: 34,732,682 (GRCm39) N286S unknown Het
Caps2 A T 10: 112,031,829 (GRCm39) I322F possibly damaging Het
Cbx3 T A 6: 51,455,533 (GRCm39) S95T probably benign Het
Ccdc24 T C 4: 117,727,102 (GRCm39) T83A unknown Het
Cntn1 T C 15: 92,140,864 (GRCm39) Y197H probably damaging Het
Cpd A G 11: 76,675,275 (GRCm39) I1282T possibly damaging Het
Crat A T 2: 30,295,052 (GRCm39) S454R probably damaging Het
D2hgdh G A 1: 93,754,338 (GRCm39) V126I probably benign Het
Dcst1 A G 3: 89,271,558 (GRCm39) V75A probably benign Het
Dnm1l T C 16: 16,176,668 (GRCm39) D21G probably benign Het
Evc2 A G 5: 37,504,823 (GRCm39) N74D probably benign Het
Gm19965 A T 1: 116,748,942 (GRCm39) M208L Het
Gprin1 C T 13: 54,886,778 (GRCm39) V499M probably benign Het
Gtf3c5 A G 2: 28,463,577 (GRCm39) Y194H probably damaging Het
Hcn4 T C 9: 58,767,880 (GRCm39) V1147A possibly damaging Het
Ighv1-82 A C 12: 115,916,342 (GRCm39) V56G probably damaging Het
Ins2 T C 7: 142,232,505 (GRCm39) D93G possibly damaging Het
Itgb8 A G 12: 119,130,535 (GRCm39) S658P probably benign Het
Kcnmb1 T C 11: 33,920,263 (GRCm39) F159L probably benign Het
Klf1 C T 8: 85,629,954 (GRCm39) L260F probably benign Het
Larp4 T A 15: 99,888,205 (GRCm39) S140T possibly damaging Het
Maneal C A 4: 124,755,542 (GRCm39) R140L probably benign Het
Mfsd11 T A 11: 116,750,323 (GRCm39) V114D Het
Muc4 A G 16: 32,752,617 (GRCm38) T832A probably benign Het
Myh11 T G 16: 14,050,439 (GRCm39) I509L Het
Myh13 A T 11: 67,252,149 (GRCm39) E1419V probably damaging Het
Myh7b A G 2: 155,474,439 (GRCm39) E1718G probably damaging Het
Myo9b T A 8: 71,807,871 (GRCm39) probably benign Het
Notch1 A T 2: 26,367,939 (GRCm39) L656Q probably benign Het
Nova1 A G 12: 46,746,813 (GRCm39) I488T probably damaging Het
Or51r1 A T 7: 102,228,500 (GRCm39) E266V probably damaging Het
Or5b113 A T 19: 13,342,222 (GRCm39) T77S possibly damaging Het
Or5b21 A G 19: 12,839,976 (GRCm39) Y279C probably damaging Het
Or5d18 A G 2: 87,864,697 (GRCm39) V262A probably damaging Het
Or6c35 A G 10: 129,169,623 (GRCm39) N291S probably damaging Het
Or6d13 A T 6: 116,517,990 (GRCm39) N192I possibly damaging Het
Pax6 C T 2: 105,523,097 (GRCm39) S325L probably benign Het
Phldb1 T C 9: 44,619,740 (GRCm39) D142G probably null Het
Phldb3 T G 7: 24,324,048 (GRCm39) probably benign Het
Pikfyve G T 1: 65,235,898 (GRCm39) R190L probably damaging Het
Plagl2 A T 2: 153,074,540 (GRCm39) H120Q probably damaging Het
Pou2f1 A T 1: 165,703,640 (GRCm39) probably benign Het
Pramel58 A G 5: 94,831,836 (GRCm39) Y281C possibly damaging Het
Prpf6 A G 2: 181,250,001 (GRCm39) R54G possibly damaging Het
Prss33 T C 17: 24,052,966 (GRCm39) E236G probably benign Het
Ptpru T C 4: 131,522,278 (GRCm39) Y709C probably benign Het
Rcc1l A G 5: 134,197,057 (GRCm39) V212A probably benign Het
Rtl1 G A 12: 109,560,007 (GRCm39) L611F Het
Scp2 A G 4: 107,931,603 (GRCm39) I344T possibly damaging Het
Serpinb2 A T 1: 107,449,890 (GRCm39) D101V possibly damaging Het
Slc13a1 T C 6: 24,097,662 (GRCm39) T422A probably damaging Het
Slc38a10 G T 11: 120,007,762 (GRCm39) T406K probably benign Het
Smad4 T C 18: 73,782,806 (GRCm39) E376G probably damaging Het
Smarcb1 T C 10: 75,750,916 (GRCm39) E115G probably benign Het
Spata31h1 A T 10: 82,120,928 (GRCm39) H4027Q probably damaging Het
Taf5 G A 19: 47,063,370 (GRCm39) V307I probably damaging Het
Tnc T C 4: 63,938,686 (GRCm39) N51S possibly damaging Het
Trp53inp2 G T 2: 155,228,558 (GRCm39) R171L possibly damaging Het
Ttc13 A T 8: 125,402,021 (GRCm39) D579E probably benign Het
Ttn A T 2: 76,775,896 (GRCm39) N1761K unknown Het
Ttpa C T 4: 20,008,401 (GRCm39) probably benign Het
Ugt3a1 G A 15: 9,362,051 (GRCm39) V276I probably benign Het
Usp4 T A 9: 108,244,011 (GRCm39) H296Q probably benign Het
Vmn1r119 T A 7: 20,745,593 (GRCm39) H263L possibly damaging Het
Vmn2r81 A G 10: 79,103,905 (GRCm39) D176G Het
Wdr1 A T 5: 38,687,468 (GRCm39) probably benign Het
Zfp488 T G 14: 33,692,695 (GRCm39) Q156P possibly damaging Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51,491,526 (GRCm39) missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51,503,180 (GRCm39) missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51,502,819 (GRCm39) missense probably benign
IGL02317:Gprc6a APN 10 51,497,049 (GRCm39) missense probably benign 0.01
IGL02995:Gprc6a APN 10 51,502,895 (GRCm39) missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51,492,699 (GRCm39) missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51,504,445 (GRCm39) missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51,491,968 (GRCm39) missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51,491,355 (GRCm39) missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51,504,533 (GRCm39) missense probably benign 0.01
R1831:Gprc6a UTSW 10 51,491,902 (GRCm39) missense probably benign 0.22
R2108:Gprc6a UTSW 10 51,491,304 (GRCm39) missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2160:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2162:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2229:Gprc6a UTSW 10 51,502,891 (GRCm39) missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51,504,392 (GRCm39) missense probably benign 0.02
R3709:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3710:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3737:Gprc6a UTSW 10 51,503,007 (GRCm39) missense probably benign
R3914:Gprc6a UTSW 10 51,504,371 (GRCm39) missense probably benign 0.00
R3918:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3964:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3965:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3966:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3973:Gprc6a UTSW 10 51,504,544 (GRCm39) missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3978:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3979:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R4306:Gprc6a UTSW 10 51,492,735 (GRCm39) missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4405:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4408:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4713:Gprc6a UTSW 10 51,507,553 (GRCm39) unclassified probably benign
R4788:Gprc6a UTSW 10 51,491,104 (GRCm39) missense probably benign 0.00
R5248:Gprc6a UTSW 10 51,491,089 (GRCm39) missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51,502,900 (GRCm39) missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51,502,798 (GRCm39) missense probably benign
R5721:Gprc6a UTSW 10 51,491,076 (GRCm39) missense probably benign 0.06
R6061:Gprc6a UTSW 10 51,491,907 (GRCm39) missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51,491,173 (GRCm39) missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51,491,356 (GRCm39) missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51,491,008 (GRCm39) missense probably benign 0.44
R6207:Gprc6a UTSW 10 51,502,931 (GRCm39) missense probably benign 0.36
R6497:Gprc6a UTSW 10 51,491,797 (GRCm39) missense probably benign 0.05
R6717:Gprc6a UTSW 10 51,491,233 (GRCm39) missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51,507,412 (GRCm39) missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51,502,841 (GRCm39) nonsense probably null
R7000:Gprc6a UTSW 10 51,491,143 (GRCm39) missense probably benign 0.34
R7019:Gprc6a UTSW 10 51,507,508 (GRCm39) missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51,490,986 (GRCm39) missense probably benign
R7173:Gprc6a UTSW 10 51,504,595 (GRCm39) missense probably benign 0.01
R7579:Gprc6a UTSW 10 51,502,883 (GRCm39) missense probably benign
R7736:Gprc6a UTSW 10 51,491,549 (GRCm39) missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51,491,026 (GRCm39) missense probably benign 0.02
R8273:Gprc6a UTSW 10 51,507,370 (GRCm39) missense probably benign
R8329:Gprc6a UTSW 10 51,503,355 (GRCm39) nonsense probably null
R8517:Gprc6a UTSW 10 51,507,337 (GRCm39) missense probably benign 0.00
R8723:Gprc6a UTSW 10 51,491,518 (GRCm39) missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51,497,079 (GRCm39) missense probably benign 0.00
R8829:Gprc6a UTSW 10 51,491,295 (GRCm39) missense probably damaging 0.99
R9420:Gprc6a UTSW 10 51,491,506 (GRCm39) missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51,504,364 (GRCm39) missense probably benign 0.20
R9766:Gprc6a UTSW 10 51,491,884 (GRCm39) missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51,491,305 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTGCAAAACAGCCTAGGAC -3'
(R):5'- GAGGTGGGACTCTTTCTTAAACTG -3'

Sequencing Primer
(F):5'- GGACAAAAATCACCTTAAGTTTCCTG -3'
(R):5'- GGAGATGCAGTGTCTTCA -3'
Posted On 2022-01-20