Incidental Mutation 'R9151:Gprc6a'
ID 695042
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9151 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 51614823-51631461 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 51621086 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 454 (T454P)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect possibly damaging
Transcript: ENSMUST00000020062
AA Change: T454P

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: T454P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218684
AA Change: T279P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000219286
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (71/71)
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,285,094 H4027Q probably damaging Het
Abca5 A G 11: 110,298,082 F850L probably benign Het
Adam1a A T 5: 121,519,348 D627E probably damaging Het
Add2 C A 6: 86,104,477 probably benign Het
Anpep T C 7: 79,842,037 N72S probably benign Het
Aqp6 A G 15: 99,603,774 T238A possibly damaging Het
Arhgef38 G T 3: 133,206,945 T111K Het
Atg10 A G 13: 91,040,913 Y93H probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Cald1 A G 6: 34,755,747 N286S unknown Het
Caps2 A T 10: 112,195,924 I322F possibly damaging Het
Cbx3 T A 6: 51,478,553 S95T probably benign Het
Ccdc24 T C 4: 117,869,905 T83A unknown Het
Cntn1 T C 15: 92,242,983 Y197H probably damaging Het
Cpd A G 11: 76,784,449 I1282T possibly damaging Het
Crat A T 2: 30,405,040 S454R probably damaging Het
D2hgdh G A 1: 93,826,616 V126I probably benign Het
Dcst1 A G 3: 89,364,251 V75A probably benign Het
Dnm1l T C 16: 16,358,804 D21G probably benign Het
Evc2 A G 5: 37,347,479 N74D probably benign Het
Gm19965 A T 1: 116,821,212 M208L Het
Gm6205 A G 5: 94,683,977 Y281C possibly damaging Het
Gprin1 C T 13: 54,738,965 V499M probably benign Het
Gtf3c5 A G 2: 28,573,565 Y194H probably damaging Het
Hcn4 T C 9: 58,860,597 V1147A possibly damaging Het
Ighv1-82 A C 12: 115,952,722 V56G probably damaging Het
Ins2 T C 7: 142,678,768 D93G possibly damaging Het
Itgb8 A G 12: 119,166,800 S658P probably benign Het
Kcnmb1 T C 11: 33,970,263 F159L probably benign Het
Klf1 C T 8: 84,903,325 L260F probably benign Het
Larp4 T A 15: 99,990,324 S140T possibly damaging Het
Maneal C A 4: 124,861,749 R140L probably benign Het
Mfsd11 T A 11: 116,859,497 V114D Het
Muc4 A G 16: 32,752,617 T832A probably benign Het
Myh11 T G 16: 14,232,575 I509L Het
Myh13 A T 11: 67,361,323 E1419V probably damaging Het
Myh7b A G 2: 155,632,519 E1718G probably damaging Het
Myo9b T A 8: 71,355,227 probably benign Het
Notch1 A T 2: 26,477,927 L656Q probably benign Het
Nova1 A G 12: 46,700,030 I488T probably damaging Het
Olfr1444 A G 19: 12,862,612 Y279C probably damaging Het
Olfr1467 A T 19: 13,364,858 T77S possibly damaging Het
Olfr213 A T 6: 116,541,029 N192I possibly damaging Het
Olfr550 A T 7: 102,579,293 E266V probably damaging Het
Olfr73 A G 2: 88,034,353 V262A probably damaging Het
Olfr781 A G 10: 129,333,754 N291S probably damaging Het
Pax6 C T 2: 105,692,752 S325L probably benign Het
Phldb1 T C 9: 44,708,443 D142G probably null Het
Phldb3 T G 7: 24,624,623 probably benign Het
Pikfyve G T 1: 65,196,739 R190L probably damaging Het
Plagl2 A T 2: 153,232,620 H120Q probably damaging Het
Pou2f1 A T 1: 165,876,071 probably benign Het
Prpf6 A G 2: 181,608,208 R54G possibly damaging Het
Prss33 T C 17: 23,833,992 E236G probably benign Het
Ptpru T C 4: 131,794,967 Y709C probably benign Het
Rcc1l A G 5: 134,168,218 V212A probably benign Het
Rtl1 G A 12: 109,593,573 L611F Het
Scp2 A G 4: 108,074,406 I344T possibly damaging Het
Serpinb2 A T 1: 107,522,160 D101V possibly damaging Het
Slc13a1 T C 6: 24,097,663 T422A probably damaging Het
Slc38a10 G T 11: 120,116,936 T406K probably benign Het
Smad4 T C 18: 73,649,735 E376G probably damaging Het
Smarcb1 T C 10: 75,915,082 E115G probably benign Het
Taf5 G A 19: 47,074,931 V307I probably damaging Het
Tnc T C 4: 64,020,449 N51S possibly damaging Het
Trp53inp2 G T 2: 155,386,638 R171L possibly damaging Het
Ttc13 A T 8: 124,675,282 D579E probably benign Het
Ttn A T 2: 76,945,552 N1761K unknown Het
Ttpa C T 4: 20,008,401 probably benign Het
Ugt3a2 G A 15: 9,361,965 V276I probably benign Het
Usp4 T A 9: 108,366,812 H296Q probably benign Het
Vmn1r119 T A 7: 21,011,668 H263L possibly damaging Het
Vmn2r81 A G 10: 79,268,071 D176G Het
Wdr1 A T 5: 38,530,125 probably benign Het
Zfp488 T G 14: 33,970,738 Q156P possibly damaging Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51614930 missense probably benign 0.02
R8273:Gprc6a UTSW 10 51631274 missense probably benign
R8329:Gprc6a UTSW 10 51627259 nonsense probably null
R8517:Gprc6a UTSW 10 51631241 missense probably benign 0.00
R8723:Gprc6a UTSW 10 51615422 missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51620983 missense probably benign 0.00
R8829:Gprc6a UTSW 10 51615199 missense probably damaging 0.99
R9420:Gprc6a UTSW 10 51615410 missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51628268 missense probably benign 0.20
R9766:Gprc6a UTSW 10 51615788 missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51615299 missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51615299 missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51615209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTGCAAAACAGCCTAGGAC -3'
(R):5'- GAGGTGGGACTCTTTCTTAAACTG -3'

Sequencing Primer
(F):5'- GGACAAAAATCACCTTAAGTTTCCTG -3'
(R):5'- GGAGATGCAGTGTCTTCA -3'
Posted On 2022-01-20