Incidental Mutation 'R9151:Cpd'
ID 695050
Institutional Source Beutler Lab
Gene Symbol Cpd
Ensembl Gene ENSMUSG00000020841
Gene Name carboxypeptidase D
Synonyms D830034L15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock # R9151 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 76778424-76847018 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76784449 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1282 (I1282T)
Ref Sequence ENSEMBL: ENSMUSP00000021201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021201]
AlphaFold O89001
Predicted Effect possibly damaging
Transcript: ENSMUST00000021201
AA Change: I1282T

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021201
Gene: ENSMUSG00000020841
AA Change: I1282T

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Zn_pept 62 471 1.71e-52 SMART
Zn_pept 502 900 2.11e-66 SMART
Zn_pept 930 1195 1.11e-42 SMART
Pfam:CarboxypepD_reg 1211 1284 3.6e-10 PFAM
transmembrane domain 1297 1319 N/A INTRINSIC
low complexity region 1363 1371 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The metallocarboxypeptidase family of enzymes is divided into 2 subfamilies based on sequence similarities. The pancreatic carboxypeptidase-like and the regulatory B-type carboxypeptidase subfamilies. Carboxypeptidase D has been identified as a regulatory B-type carboxypeptidase. CPD is a homolog of duck gp180, a hepatitis B virus-binding protein. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,285,094 H4027Q probably damaging Het
Abca5 A G 11: 110,298,082 F850L probably benign Het
Adam1a A T 5: 121,519,348 D627E probably damaging Het
Add2 C A 6: 86,104,477 probably benign Het
Anpep T C 7: 79,842,037 N72S probably benign Het
Aqp6 A G 15: 99,603,774 T238A possibly damaging Het
Arhgef38 G T 3: 133,206,945 T111K Het
Atg10 A G 13: 91,040,913 Y93H probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Cald1 A G 6: 34,755,747 N286S unknown Het
Caps2 A T 10: 112,195,924 I322F possibly damaging Het
Cbx3 T A 6: 51,478,553 S95T probably benign Het
Ccdc24 T C 4: 117,869,905 T83A unknown Het
Cntn1 T C 15: 92,242,983 Y197H probably damaging Het
Crat A T 2: 30,405,040 S454R probably damaging Het
D2hgdh G A 1: 93,826,616 V126I probably benign Het
Dcst1 A G 3: 89,364,251 V75A probably benign Het
Dnm1l T C 16: 16,358,804 D21G probably benign Het
Evc2 A G 5: 37,347,479 N74D probably benign Het
Gm19965 A T 1: 116,821,212 M208L Het
Gm6205 A G 5: 94,683,977 Y281C possibly damaging Het
Gprc6a T G 10: 51,621,086 T454P possibly damaging Het
Gprin1 C T 13: 54,738,965 V499M probably benign Het
Gtf3c5 A G 2: 28,573,565 Y194H probably damaging Het
Hcn4 T C 9: 58,860,597 V1147A possibly damaging Het
Ighv1-82 A C 12: 115,952,722 V56G probably damaging Het
Ins2 T C 7: 142,678,768 D93G possibly damaging Het
Itgb8 A G 12: 119,166,800 S658P probably benign Het
Kcnmb1 T C 11: 33,970,263 F159L probably benign Het
Klf1 C T 8: 84,903,325 L260F probably benign Het
Larp4 T A 15: 99,990,324 S140T possibly damaging Het
Maneal C A 4: 124,861,749 R140L probably benign Het
Mfsd11 T A 11: 116,859,497 V114D Het
Muc4 A G 16: 32,752,617 T832A probably benign Het
Myh11 T G 16: 14,232,575 I509L Het
Myh13 A T 11: 67,361,323 E1419V probably damaging Het
Myh7b A G 2: 155,632,519 E1718G probably damaging Het
Myo9b T A 8: 71,355,227 probably benign Het
Notch1 A T 2: 26,477,927 L656Q probably benign Het
Nova1 A G 12: 46,700,030 I488T probably damaging Het
Olfr1444 A G 19: 12,862,612 Y279C probably damaging Het
Olfr1467 A T 19: 13,364,858 T77S possibly damaging Het
Olfr213 A T 6: 116,541,029 N192I possibly damaging Het
Olfr550 A T 7: 102,579,293 E266V probably damaging Het
Olfr73 A G 2: 88,034,353 V262A probably damaging Het
Olfr781 A G 10: 129,333,754 N291S probably damaging Het
Pax6 C T 2: 105,692,752 S325L probably benign Het
Phldb1 T C 9: 44,708,443 D142G probably null Het
Phldb3 T G 7: 24,624,623 probably benign Het
Pikfyve G T 1: 65,196,739 R190L probably damaging Het
Plagl2 A T 2: 153,232,620 H120Q probably damaging Het
Pou2f1 A T 1: 165,876,071 probably benign Het
Prpf6 A G 2: 181,608,208 R54G possibly damaging Het
Prss33 T C 17: 23,833,992 E236G probably benign Het
Ptpru T C 4: 131,794,967 Y709C probably benign Het
Rcc1l A G 5: 134,168,218 V212A probably benign Het
Rtl1 G A 12: 109,593,573 L611F Het
Scp2 A G 4: 108,074,406 I344T possibly damaging Het
Serpinb2 A T 1: 107,522,160 D101V possibly damaging Het
Slc13a1 T C 6: 24,097,663 T422A probably damaging Het
Slc38a10 G T 11: 120,116,936 T406K probably benign Het
Smad4 T C 18: 73,649,735 E376G probably damaging Het
Smarcb1 T C 10: 75,915,082 E115G probably benign Het
Taf5 G A 19: 47,074,931 V307I probably damaging Het
Tnc T C 4: 64,020,449 N51S possibly damaging Het
Trp53inp2 G T 2: 155,386,638 R171L possibly damaging Het
Ttc13 A T 8: 124,675,282 D579E probably benign Het
Ttn A T 2: 76,945,552 N1761K unknown Het
Ttpa C T 4: 20,008,401 probably benign Het
Ugt3a2 G A 15: 9,361,965 V276I probably benign Het
Usp4 T A 9: 108,366,812 H296Q probably benign Het
Vmn1r119 T A 7: 21,011,668 H263L possibly damaging Het
Vmn2r81 A G 10: 79,268,071 D176G Het
Wdr1 A T 5: 38,530,125 probably benign Het
Zfp488 T G 14: 33,970,738 Q156P possibly damaging Het
Other mutations in Cpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Cpd APN 11 76797789 missense probably benign 0.00
IGL00698:Cpd APN 11 76840444 missense possibly damaging 0.82
IGL01025:Cpd APN 11 76795613 missense probably damaging 1.00
IGL01292:Cpd APN 11 76846245 missense possibly damaging 0.80
IGL01571:Cpd APN 11 76782296 missense probably damaging 1.00
IGL01606:Cpd APN 11 76812640 missense probably benign
IGL02283:Cpd APN 11 76840425 missense probably benign 0.19
IGL02895:Cpd APN 11 76785203 missense probably benign 0.06
IGL02965:Cpd APN 11 76790988 splice site probably benign
IGL03116:Cpd APN 11 76811713 missense probably damaging 1.00
IGL03178:Cpd APN 11 76806051 missense probably benign 0.02
PIT4280001:Cpd UTSW 11 76791024 missense probably benign 0.23
PIT4382001:Cpd UTSW 11 76797788 missense probably benign
R0050:Cpd UTSW 11 76792859 missense possibly damaging 0.94
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0320:Cpd UTSW 11 76840447 missense possibly damaging 0.50
R0416:Cpd UTSW 11 76785204 missense probably benign 0.13
R0556:Cpd UTSW 11 76802345 splice site probably benign
R0666:Cpd UTSW 11 76782327 missense probably damaging 1.00
R0668:Cpd UTSW 11 76784398 missense probably damaging 1.00
R1180:Cpd UTSW 11 76801753 missense possibly damaging 0.56
R1472:Cpd UTSW 11 76784398 missense probably damaging 0.98
R1518:Cpd UTSW 11 76840386 critical splice donor site probably null
R1617:Cpd UTSW 11 76846669 missense probably damaging 1.00
R1786:Cpd UTSW 11 76792798 missense probably benign 0.00
R1854:Cpd UTSW 11 76786338 missense probably damaging 1.00
R1861:Cpd UTSW 11 76784382 splice site probably benign
R2159:Cpd UTSW 11 76797641 missense probably damaging 0.96
R2205:Cpd UTSW 11 76802244 missense probably damaging 0.99
R2281:Cpd UTSW 11 76797801 missense probably benign 0.00
R2680:Cpd UTSW 11 76790999 missense probably benign
R2928:Cpd UTSW 11 76846374 missense probably benign
R2937:Cpd UTSW 11 76811859 missense probably damaging 1.00
R4133:Cpd UTSW 11 76814818 nonsense probably null
R4241:Cpd UTSW 11 76846785 missense probably benign 0.03
R4369:Cpd UTSW 11 76797711 missense possibly damaging 0.82
R4538:Cpd UTSW 11 76790999 missense probably benign
R4551:Cpd UTSW 11 76811886 missense probably damaging 1.00
R4617:Cpd UTSW 11 76840615 missense probably damaging 1.00
R4732:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4733:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4821:Cpd UTSW 11 76846237 missense probably benign 0.38
R4852:Cpd UTSW 11 76785150 missense probably benign 0.32
R4901:Cpd UTSW 11 76790881 missense probably damaging 1.00
R4988:Cpd UTSW 11 76814830 missense probably damaging 0.98
R4999:Cpd UTSW 11 76846222 critical splice donor site probably null
R5005:Cpd UTSW 11 76813570 missense probably damaging 1.00
R5092:Cpd UTSW 11 76811704 missense possibly damaging 0.75
R5438:Cpd UTSW 11 76791966 missense possibly damaging 0.65
R5524:Cpd UTSW 11 76797901 nonsense probably null
R5677:Cpd UTSW 11 76799825 missense probably benign
R5826:Cpd UTSW 11 76784416 nonsense probably null
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6103:Cpd UTSW 11 76799799 missense probably benign 0.00
R6257:Cpd UTSW 11 76812670 missense probably benign 0.37
R6263:Cpd UTSW 11 76846271 missense probably benign 0.00
R6485:Cpd UTSW 11 76808707 splice site probably null
R6671:Cpd UTSW 11 76795533 missense probably damaging 1.00
R6995:Cpd UTSW 11 76785055 missense probably benign 0.02
R7074:Cpd UTSW 11 76813594 missense probably damaging 1.00
R7192:Cpd UTSW 11 76814841 missense probably damaging 1.00
R7341:Cpd UTSW 11 76846953 missense unknown
R7371:Cpd UTSW 11 76846611 missense probably benign 0.25
R7380:Cpd UTSW 11 76802325 nonsense probably null
R7392:Cpd UTSW 11 76801779 missense probably damaging 1.00
R7410:Cpd UTSW 11 76782308 missense probably damaging 1.00
R7509:Cpd UTSW 11 76797876 missense probably benign 0.17
R7767:Cpd UTSW 11 76813559 missense probably benign 0.03
R8935:Cpd UTSW 11 76840469 missense probably damaging 1.00
R9172:Cpd UTSW 11 76784426 missense probably benign 0.21
R9173:Cpd UTSW 11 76808823 missense probably damaging 0.97
R9310:Cpd UTSW 11 76814781 nonsense probably null
R9666:Cpd UTSW 11 76802307 missense probably benign 0.02
Z1088:Cpd UTSW 11 76801746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTAGGGGAAAAGCAACTAGC -3'
(R):5'- TCAGTATCCTATAAGTGGCTTTTGC -3'

Sequencing Primer
(F):5'- GCAACTAGCTGGAGGTGTTTG -3'
(R):5'- GATTCCTGGATTCCCTTGAACTAGAG -3'
Posted On 2022-01-20