Incidental Mutation 'R0766:Vrk2'
ID69509
Institutional Source Beutler Lab
Gene Symbol Vrk2
Ensembl Gene ENSMUSG00000064090
Gene Namevaccinia related kinase 2
Synonyms2810003O05Rik
MMRRC Submission 038946-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R0766 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location26471322-26593999 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 26535522 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078362] [ENSMUST00000109504]
Predicted Effect probably benign
Transcript: ENSMUST00000078362
SMART Domains Protein: ENSMUSP00000077471
Gene: ENSMUSG00000064090

DomainStartEndE-ValueType
Pfam:Pkinase 29 298 4.4e-18 PFAM
Pfam:Pkinase_Tyr 29 313 2e-11 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109504
SMART Domains Protein: ENSMUSP00000105130
Gene: ENSMUSG00000064090

DomainStartEndE-ValueType
Pfam:Pkinase 29 302 2.8e-22 PFAM
Pfam:Pkinase_Tyr 29 313 1.3e-11 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133487
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. The encoded protein acts as an effector of signaling pathways that regulate apoptosis and tumor cell growth. Variants in this gene have been associated with schizophrenia. Alternative splicing results in multiple transcript variants that differ in their subcellular localization and biological activity. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A T 4: 103,270,797 F44I probably damaging Het
A2m T C 6: 121,676,890 probably benign Het
Card14 T C 11: 119,324,176 S241P probably damaging Het
Cdh15 G A 8: 122,861,449 probably benign Het
Dnah5 A C 15: 28,448,487 K4232T probably null Het
Eml6 A G 11: 29,831,219 probably benign Het
Esd T C 14: 74,742,121 S122P probably damaging Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Herc1 C T 9: 66,504,840 P4781S probably damaging Het
Iqch G A 9: 63,482,683 S738L probably benign Het
Itih2 T A 2: 10,097,924 T800S probably benign Het
Itpr1 A G 6: 108,410,900 E1533G probably damaging Het
Klrg1 T C 6: 122,279,663 M55V probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Otos A C 1: 92,645,351 L14R probably damaging Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rel G A 11: 23,757,010 T64I probably damaging Het
Snai2 T A 16: 14,708,247 M254K possibly damaging Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tex22 A G 12: 113,088,523 N67S possibly damaging Het
Trank1 T G 9: 111,347,469 S270A probably benign Het
Ttc30a2 A T 2: 75,976,332 V612D probably benign Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r167 A G 7: 23,505,123 F156S probably benign Het
Wdfy4 T C 14: 33,140,612 E601G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp638 A G 6: 83,929,041 N63D probably damaging Het
Other mutations in Vrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Vrk2 APN 11 26535560 missense possibly damaging 0.73
IGL02011:Vrk2 APN 11 26471717 missense probably benign 0.10
IGL02185:Vrk2 APN 11 26535638 nonsense probably null
IGL02257:Vrk2 APN 11 26534266 missense probably damaging 1.00
IGL02424:Vrk2 APN 11 26476564 missense probably benign 0.00
macromacro UTSW 11 26549325 missense probably damaging 1.00
R0127:Vrk2 UTSW 11 26534313 splice site probably benign
R0184:Vrk2 UTSW 11 26550046 missense probably damaging 0.98
R0670:Vrk2 UTSW 11 26486959 critical splice donor site probably null
R0751:Vrk2 UTSW 11 26483331 splice site probably benign
R1103:Vrk2 UTSW 11 26549325 missense probably damaging 1.00
R1184:Vrk2 UTSW 11 26483331 splice site probably benign
R1312:Vrk2 UTSW 11 26535522 splice site probably benign
R2041:Vrk2 UTSW 11 26547914 missense probably benign 0.01
R2857:Vrk2 UTSW 11 26483324 missense possibly damaging 0.54
R2859:Vrk2 UTSW 11 26483324 missense possibly damaging 0.54
R3615:Vrk2 UTSW 11 26489866 missense possibly damaging 0.90
R3616:Vrk2 UTSW 11 26489866 missense possibly damaging 0.90
R4163:Vrk2 UTSW 11 26547915 missense probably benign 0.00
R4651:Vrk2 UTSW 11 26489803 missense probably damaging 0.98
R4652:Vrk2 UTSW 11 26489803 missense probably damaging 0.98
R4662:Vrk2 UTSW 11 26471611 missense possibly damaging 0.95
R5262:Vrk2 UTSW 11 26591697 missense possibly damaging 0.94
R5458:Vrk2 UTSW 11 26498919 missense probably damaging 0.99
R5529:Vrk2 UTSW 11 26499036 missense probably damaging 1.00
R5840:Vrk2 UTSW 11 26534314 splice site probably benign
R5892:Vrk2 UTSW 11 26534372 intron probably benign
R6054:Vrk2 UTSW 11 26486975 missense probably benign 0.20
R6923:Vrk2 UTSW 11 26489893 missense probably damaging 1.00
R6952:Vrk2 UTSW 11 26535597 missense probably damaging 0.97
R7841:Vrk2 UTSW 11 26471457 missense probably damaging 1.00
R7924:Vrk2 UTSW 11 26471457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCTACGGGCTTCTTCTGAGATG -3'
(R):5'- CACTAAGCTGCTTCCCCGAAGATG -3'

Sequencing Primer
(F):5'- GCTTCTTCTGAGATGTGACAGTAAAC -3'
(R):5'- AAGATGCAGCTCACTGTGC -3'
Posted On2013-09-30