Incidental Mutation 'R9152:5830411N06Rik'
ID 695093
Institutional Source Beutler Lab
Gene Symbol 5830411N06Rik
Ensembl Gene ENSMUSG00000054672
Gene Name RIKEN cDNA 5830411N06 gene
Synonyms Scart2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9152 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 140247284-140300736 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 140297343 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 857 (N857I)
Ref Sequence ENSEMBL: ENSMUSP00000131905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]
AlphaFold B3F5L4
Predicted Effect probably benign
Transcript: ENSMUST00000093984
AA Change: N741I

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672
AA Change: N741I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
SR 446 546 8.78e-30 SMART
SR 551 651 1.26e-53 SMART
SR 656 756 2.88e-16 SMART
SR 783 883 7.62e-48 SMART
transmembrane domain 903 925 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164583
AA Change: N857I

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: N857I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
Blast:SR 291 349 5e-12 BLAST
SR 354 452 1.65e-34 SMART
SR 456 556 4.53e-32 SMART
SR 562 662 8.78e-30 SMART
SR 667 767 1.26e-53 SMART
SR 772 872 2.88e-16 SMART
SR 899 999 7.62e-48 SMART
transmembrane domain 1019 1041 N/A INTRINSIC
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 C A 13: 104,476,767 R1009S probably benign Het
Akap13 T A 7: 75,611,285 I1219K probably damaging Het
Ap3b1 T C 13: 94,472,931 probably null Het
Ap3b1 T A 13: 94,493,731 D831E unknown Het
Arsa G A 15: 89,475,792 probably benign Het
Clrn2 T C 5: 45,463,912 I216T probably benign Het
Cspg4 A G 9: 56,888,179 K1066R probably benign Het
Cul4a T C 8: 13,105,799 M15T probably benign Het
Defb38 C T 8: 19,026,542 probably benign Het
Dnah9 T C 11: 66,130,631 D323G probably damaging Het
Dsg1c T A 18: 20,283,272 D743E probably benign Het
Elf1 T C 14: 79,570,912 L268P probably damaging Het
Gm2056 T C 12: 88,027,176 L58P probably damaging Het
H2afy CTTACCTCCAGCT C 13: 56,084,191 probably null Het
Helq G T 5: 100,770,459 A863D probably benign Het
Hfm1 T A 5: 106,841,745 R1368S probably benign Het
Hspg2 G A 4: 137,522,565 G1379E possibly damaging Het
Kcnq5 A T 1: 21,469,468 probably null Het
Lrit2 C T 14: 37,072,230 T417I probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mgat2 G A 12: 69,185,723 W357* probably null Het
Mlkl A G 8: 111,319,771 L290P probably damaging Het
Olfr267 T C 4: 58,785,114 I203V probably benign Het
Olfr339 T A 2: 36,421,427 S10T possibly damaging Het
Olfr851 A T 9: 19,497,152 I135F probably damaging Het
Pcnx T C 12: 81,975,815 V853A Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pik3c2a G A 7: 116,417,769 S251L probably benign Het
Prkch T C 12: 73,691,644 M175T possibly damaging Het
Psg22 A T 7: 18,726,721 Q425L probably damaging Het
Qpctl A G 7: 19,149,100 L29P probably damaging Het
Ranbp10 A T 8: 105,772,508 L549M probably benign Het
Rbbp6 A G 7: 123,001,474 E1568G unknown Het
Rrh A T 3: 129,813,254 D173E probably benign Het
Selplg A G 5: 113,819,406 S280P probably benign Het
Sept11 T C 5: 93,139,470 S17P probably benign Het
Stard9 T C 2: 120,698,587 V1775A probably damaging Het
Tep1 A C 14: 50,866,705 V244G probably benign Het
Tex24 A C 8: 27,345,351 E302D possibly damaging Het
Trav18 A G 14: 53,831,554 T19A probably benign Het
Trim56 T C 5: 137,114,533 D43G probably benign Het
Trp53bp1 T C 2: 121,198,575 T1869A probably damaging Het
Usp22 A G 11: 61,158,375 C383R probably damaging Het
Zdhhc22 G A 12: 86,988,418 P87S probably benign Het
Other mutations in 5830411N06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:5830411N06Rik APN 7 140294842 missense probably damaging 0.99
IGL01101:5830411N06Rik APN 7 140296104 missense probably benign 0.35
IGL01120:5830411N06Rik APN 7 140296559 missense probably benign 0.02
IGL01958:5830411N06Rik APN 7 140274127 missense probably damaging 1.00
IGL02150:5830411N06Rik APN 7 140297859 missense possibly damaging 0.84
IGL02193:5830411N06Rik APN 7 140249000 missense probably benign 0.17
IGL02239:5830411N06Rik APN 7 140295843 missense probably damaging 1.00
IGL02335:5830411N06Rik APN 7 140296540 missense probably damaging 1.00
IGL02569:5830411N06Rik APN 7 140298362 missense probably benign 0.01
IGL02993:5830411N06Rik APN 7 140296573 missense probably benign 0.07
IGL03261:5830411N06Rik APN 7 140294833 missense probably benign 0.00
IGL03365:5830411N06Rik APN 7 140296769 missense probably damaging 1.00
IGL03399:5830411N06Rik APN 7 140247956 missense probably benign 0.00
IGL03052:5830411N06Rik UTSW 7 140248914 missense probably damaging 1.00
PIT4791001:5830411N06Rik UTSW 7 140274062 missense possibly damaging 0.53
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0347:5830411N06Rik UTSW 7 140297854 missense probably damaging 1.00
R0374:5830411N06Rik UTSW 7 140248961 missense probably damaging 1.00
R0639:5830411N06Rik UTSW 7 140247959 missense probably benign 0.01
R0667:5830411N06Rik UTSW 7 140261537 missense possibly damaging 0.73
R0789:5830411N06Rik UTSW 7 140248220 missense probably damaging 1.00
R0959:5830411N06Rik UTSW 7 140294791 missense probably damaging 1.00
R1316:5830411N06Rik UTSW 7 140299670 missense probably benign 0.09
R1764:5830411N06Rik UTSW 7 140297265 missense probably benign 0.00
R2247:5830411N06Rik UTSW 7 140249129 missense probably null 0.96
R2379:5830411N06Rik UTSW 7 140299769 missense probably benign 0.15
R4112:5830411N06Rik UTSW 7 140298368 nonsense probably null
R4114:5830411N06Rik UTSW 7 140297910 missense probably damaging 1.00
R4346:5830411N06Rik UTSW 7 140247965 missense probably damaging 0.97
R4836:5830411N06Rik UTSW 7 140299108 missense probably benign
R4956:5830411N06Rik UTSW 7 140298362 missense probably benign 0.00
R5208:5830411N06Rik UTSW 7 140298036 missense probably benign 0.00
R5571:5830411N06Rik UTSW 7 140249123 missense probably damaging 1.00
R5583:5830411N06Rik UTSW 7 140296826 missense probably damaging 1.00
R5645:5830411N06Rik UTSW 7 140248940 missense possibly damaging 0.95
R6183:5830411N06Rik UTSW 7 140296034 missense possibly damaging 0.82
R6995:5830411N06Rik UTSW 7 140261601 missense probably benign
R7436:5830411N06Rik UTSW 7 140261607 missense probably benign
R7621:5830411N06Rik UTSW 7 140296829 missense probably damaging 1.00
R7662:5830411N06Rik UTSW 7 140294812 missense possibly damaging 0.58
R7669:5830411N06Rik UTSW 7 140296321 missense possibly damaging 0.47
R7686:5830411N06Rik UTSW 7 140249052 missense probably benign 0.00
R7985:5830411N06Rik UTSW 7 140296893 missense probably damaging 1.00
R8330:5830411N06Rik UTSW 7 140296318 nonsense probably null
R8843:5830411N06Rik UTSW 7 140249000 missense possibly damaging 0.93
R8888:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R8895:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R9044:5830411N06Rik UTSW 7 140248097 missense probably damaging 1.00
R9142:5830411N06Rik UTSW 7 140297893 missense probably damaging 1.00
R9470:5830411N06Rik UTSW 7 140247432 missense probably benign 0.07
R9509:5830411N06Rik UTSW 7 140299731 nonsense probably null
R9522:5830411N06Rik UTSW 7 140274074 missense possibly damaging 0.73
R9755:5830411N06Rik UTSW 7 140261631 critical splice donor site probably null
R9794:5830411N06Rik UTSW 7 140294803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTACAATGGGACCTGGGG -3'
(R):5'- GGTTTCAAAGGATATCCACAAAGC -3'

Sequencing Primer
(F):5'- TGCCAGTCTCTGAATGCTG -3'
(R):5'- GCCTGAAAATTCCACACTGCTTC -3'
Posted On 2022-01-20