Incidental Mutation 'R9152:Prkch'
ID 695104
Institutional Source Beutler Lab
Gene Symbol Prkch
Ensembl Gene ENSMUSG00000021108
Gene Name protein kinase C, eta
Synonyms Pkch
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9152 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 73584796-73778185 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73691644 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 175 (M175T)
Ref Sequence ENSEMBL: ENSMUSP00000021527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021527] [ENSMUST00000221153]
AlphaFold P23298
Predicted Effect possibly damaging
Transcript: ENSMUST00000021527
AA Change: M175T

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021527
Gene: ENSMUSG00000021108
AA Change: M175T

DomainStartEndE-ValueType
C2 11 117 1.28e-13 SMART
C1 172 222 7.92e-14 SMART
C1 246 295 2.48e-15 SMART
S_TKc 355 614 5.62e-100 SMART
S_TK_X 615 678 8.32e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221153
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipids-dependent protein kinase. It is predominantly expressed in epithelial tissues and has been shown to reside specifically in the cell nucleus. This protein kinase can regulate keratinocyte differentiation by activating the MAP kinase MAPK13 (p38delta)-activated protein kinase cascade that targets CCAAT/enhancer-binding protein alpha (CEBPA). It is also found to mediate the transcription activation of the transglutaminase 1 (TGM1) gene. Mutations in the human gene are associated with susceptibility to cerebral infarction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thymus hypoplasia, enlarged lymph nodes and alterations in T cell homeostasis and activation. Mice homozygous for a different knock-out allele show impaired wound healing and increased incidence of tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A T 7: 140,297,343 N857I possibly damaging Het
Adamts6 C A 13: 104,476,767 R1009S probably benign Het
Akap13 T A 7: 75,611,285 I1219K probably damaging Het
Ap3b1 T C 13: 94,472,931 probably null Het
Ap3b1 T A 13: 94,493,731 D831E unknown Het
Arsa G A 15: 89,475,792 probably benign Het
Clrn2 T C 5: 45,463,912 I216T probably benign Het
Cspg4 A G 9: 56,888,179 K1066R probably benign Het
Cul4a T C 8: 13,105,799 M15T probably benign Het
Defb38 C T 8: 19,026,542 probably benign Het
Dnah9 T C 11: 66,130,631 D323G probably damaging Het
Dsg1c T A 18: 20,283,272 D743E probably benign Het
Elf1 T C 14: 79,570,912 L268P probably damaging Het
Gm2056 T C 12: 88,027,176 L58P probably damaging Het
H2afy CTTACCTCCAGCT C 13: 56,084,191 probably null Het
Helq G T 5: 100,770,459 A863D probably benign Het
Hfm1 T A 5: 106,841,745 R1368S probably benign Het
Hspg2 G A 4: 137,522,565 G1379E possibly damaging Het
Kcnq5 A T 1: 21,469,468 probably null Het
Lrit2 C T 14: 37,072,230 T417I probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mgat2 G A 12: 69,185,723 W357* probably null Het
Mlkl A G 8: 111,319,771 L290P probably damaging Het
Olfr267 T C 4: 58,785,114 I203V probably benign Het
Olfr339 T A 2: 36,421,427 S10T possibly damaging Het
Olfr851 A T 9: 19,497,152 I135F probably damaging Het
Pcnx T C 12: 81,975,815 V853A Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pik3c2a G A 7: 116,417,769 S251L probably benign Het
Psg22 A T 7: 18,726,721 Q425L probably damaging Het
Qpctl A G 7: 19,149,100 L29P probably damaging Het
Ranbp10 A T 8: 105,772,508 L549M probably benign Het
Rbbp6 A G 7: 123,001,474 E1568G unknown Het
Rrh A T 3: 129,813,254 D173E probably benign Het
Selplg A G 5: 113,819,406 S280P probably benign Het
Sept11 T C 5: 93,139,470 S17P probably benign Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Stard9 T C 2: 120,698,587 V1775A probably damaging Het
Tep1 A C 14: 50,866,705 V244G probably benign Het
Tex24 A C 8: 27,345,351 E302D possibly damaging Het
Trav18 A G 14: 53,831,554 T19A probably benign Het
Trim56 T C 5: 137,114,533 D43G probably benign Het
Trp53bp1 T C 2: 121,198,575 T1869A probably damaging Het
Usp22 A G 11: 61,158,375 C383R probably damaging Het
Zdhhc22 G A 12: 86,988,418 P87S probably benign Het
Other mutations in Prkch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Prkch APN 12 73702589 splice site probably benign
IGL00548:Prkch APN 12 73702811 missense probably damaging 1.00
IGL01310:Prkch APN 12 73759013 missense possibly damaging 0.78
IGL01782:Prkch APN 12 73759662 missense probably damaging 1.00
IGL02335:Prkch APN 12 73702512 missense probably benign 0.00
wolfcreek UTSW 12 73759710 missense probably damaging 1.00
G1Funyon:Prkch UTSW 12 73702764 missense possibly damaging 0.71
R0084:Prkch UTSW 12 73697987 missense possibly damaging 0.87
R0127:Prkch UTSW 12 73721787 missense possibly damaging 0.94
R0471:Prkch UTSW 12 73691652 missense probably benign 0.03
R0490:Prkch UTSW 12 73759676 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1552:Prkch UTSW 12 73702546 missense probably benign 0.33
R1572:Prkch UTSW 12 73649357 critical splice donor site probably null
R1651:Prkch UTSW 12 73759001 missense possibly damaging 0.88
R2114:Prkch UTSW 12 73702516 missense probably benign
R3714:Prkch UTSW 12 73775516 missense probably damaging 1.00
R4515:Prkch UTSW 12 73702838 missense possibly damaging 0.76
R4749:Prkch UTSW 12 73692960 missense probably damaging 1.00
R4977:Prkch UTSW 12 73702893 missense possibly damaging 0.52
R5381:Prkch UTSW 12 73691592 missense probably damaging 0.99
R5682:Prkch UTSW 12 73697950 missense probably damaging 1.00
R6526:Prkch UTSW 12 73702775 missense probably damaging 1.00
R6864:Prkch UTSW 12 73759617 missense probably damaging 1.00
R7484:Prkch UTSW 12 73585527 critical splice donor site probably null
R8074:Prkch UTSW 12 73700267 missense possibly damaging 0.49
R8294:Prkch UTSW 12 73759710 missense probably damaging 1.00
R8301:Prkch UTSW 12 73702764 missense possibly damaging 0.71
R8312:Prkch UTSW 12 73760584 missense noncoding transcript
R8734:Prkch UTSW 12 73585244 missense possibly damaging 0.62
R8766:Prkch UTSW 12 73702538 missense probably benign 0.01
R8998:Prkch UTSW 12 73696199 missense probably damaging 1.00
R8999:Prkch UTSW 12 73696199 missense probably damaging 1.00
R9058:Prkch UTSW 12 73775534 critical splice donor site probably null
R9176:Prkch UTSW 12 73700194 missense probably damaging 1.00
R9194:Prkch UTSW 12 73721842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGACTGTGTTTGGACAAC -3'
(R):5'- GGGTCCGTAAATTACTTAGTTTTGC -3'

Sequencing Primer
(F):5'- GGTTTGCCAAGGAACCCTAAAGTTC -3'
(R):5'- CCTGTTAAAAGAGGATCAATGTATCG -3'
Posted On 2022-01-20