Mutagenetix > Incidental Mutations

Incidental Mutation 'R0766:Eml6'

69511

Institutional Source

Beutler Lab

Gene Symbol

Eml6

Ensembl Gene

ENSMUSG00000044072

Gene Name

echinoderm microtubule associated protein like 6

Synonyms

MMRRC Submission

038946-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.206) question?

Stock #

R0766 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29743048-30026033 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 29831219 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000051080 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058902]

AlphaFold

Q5SQM0

Predicted Effect

probably benign
Transcript: ENSMUST00000058902

SMART Domains

Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072

Domain	Start	End	E-Value	Type
low complexity region	36	47	N/A	INTRINSIC
WD40	49	91	1.79e-1	SMART
WD40	94	136	1.42e-4	SMART
WD40	139	178	5.31e-4	SMART
WD40	184	224	8.84e1	SMART
WD40	225	263	3.75e-4	SMART
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.22e0	SMART
WD40	397	436	1.72e0	SMART
WD40	505	546	1.7e2	SMART
WD40	552	592	4.55e-3	SMART
low complexity region	613	625	N/A	INTRINSIC
Pfam:HELP	653	715	1.9e-22	PFAM
WD40	716	757	9.24e-1	SMART
WD40	760	802	6.53e-4	SMART
WD40	805	844	2.98e-1	SMART
WD40	856	891	8.52e1	SMART
WD40	892	929	2.09e-2	SMART
WD40	986	1026	1.18e-1	SMART
WD40	1032	1068	3.44e0	SMART
WD40	1071	1111	2.58e-1	SMART
WD40	1180	1221	9.24e-1	SMART
WD40	1227	1267	3.85e-1	SMART
low complexity region	1280	1291	N/A	INTRINSIC
Pfam:HELP	1329	1402	5e-15	PFAM
WD40	1404	1447	2.66e0	SMART
WD40	1450	1492	1.85e0	SMART
WD40	1495	1534	2.97e0	SMART
WD40	1543	1582	7.1e1	SMART
WD40	1584	1629	9.51e1	SMART
WD40	1675	1715	3.05e-4	SMART
WD40	1718	1758	8.84e1	SMART
WD40	1759	1798	7.16e-1	SMART
WD40	1869	1910	1.53e1	SMART
WD40	1916	1956	4.62e-4	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 93.4%

Validation Efficiency

100% (37/37)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	A	T	4: 103,270,797	F44I	probably damaging	Het
A2m	T	C	6: 121,676,890		probably benign	Het
Card14	T	C	11: 119,324,176	S241P	probably damaging	Het
Cdh15	G	A	8: 122,861,449		probably benign	Het
Dnah5	A	C	15: 28,448,487	K4232T	probably null	Het
Esd	T	C	14: 74,742,121	S122P	probably damaging	Het
Frem3	G	A	8: 80,615,322	V1415I	probably benign	Het
Fry	T	C	5: 150,403,432		probably benign	Het
Gp1ba	C	T	11: 70,641,427	P673L	probably damaging	Het
Herc1	C	T	9: 66,504,840	P4781S	probably damaging	Het
Iqch	G	A	9: 63,482,683	S738L	probably benign	Het
Itih2	T	A	2: 10,097,924	T800S	probably benign	Het
Itpr1	A	G	6: 108,410,900	E1533G	probably damaging	Het
Klrg1	T	C	6: 122,279,663	M55V	probably benign	Het
Lrrk2	A	G	15: 91,699,895	N286S	probably damaging	Het
Mkx	T	A	18: 6,937,192	D284V	probably benign	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Otos	A	C	1: 92,645,351	L14R	probably damaging	Het
Plch2	C	T	4: 154,989,799	V765M	probably damaging	Het
Ppp4r3b	A	T	11: 29,173,358	Q18L	probably benign	Het
Psme4	T	A	11: 30,807,687		probably null	Het
Pwp1	G	A	10: 85,879,309	D220N	probably damaging	Het
Rel	G	A	11: 23,757,010	T64I	probably damaging	Het
Snai2	T	A	16: 14,708,247	M254K	possibly damaging	Het
Sntb2	A	G	8: 107,001,577	T386A	probably damaging	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tex22	A	G	12: 113,088,523	N67S	possibly damaging	Het
Trank1	T	G	9: 111,347,469	S270A	probably benign	Het
Ttc30a2	A	T	2: 75,976,332	V612D	probably benign	Het
Vcp	T	C	4: 42,988,728	T249A	possibly damaging	Het
Vmn1r167	A	G	7: 23,505,123	F156S	probably benign	Het
Vrk2	G	A	11: 26,535,522		probably benign	Het
Wdfy4	T	C	14: 33,140,612	E601G	probably damaging	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp638	A	G	6: 83,929,041	N63D	probably damaging	Het

Other mutations in Eml6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01071:Eml6	APN	11	29850816	critical splice donor site	probably null
IGL01407:Eml6	APN	11	29755021	nonsense	probably null
IGL01434:Eml6	APN	11	29819090	missense	probably damaging	1.00
IGL01578:Eml6	APN	11	29850870	missense	probably benign	0.02
IGL01780:Eml6	APN	11	29805175	missense	probably benign	0.17
IGL01821:Eml6	APN	11	29821699	missense	probably benign	0.00
IGL01837:Eml6	APN	11	29777055	missense	probably benign	0.00
IGL01904:Eml6	APN	11	29838613	nonsense	probably null
IGL01972:Eml6	APN	11	29838451	missense	possibly damaging	0.67
IGL02134:Eml6	APN	11	29759066	missense	probably benign	0.13
IGL02192:Eml6	APN	11	29805743	missense	probably benign	0.00
IGL02377:Eml6	APN	11	29777282	missense	probably damaging	0.98
IGL02584:Eml6	APN	11	29749387	missense	probably damaging	0.99
IGL02587:Eml6	APN	11	29784236	missense	possibly damaging	0.92
IGL02810:Eml6	APN	11	29849016	missense	possibly damaging	0.94
IGL02873:Eml6	APN	11	29880700	missense	probably benign	0.10
IGL02880:Eml6	APN	11	29749959	missense	probably benign	0.03
IGL03289:Eml6	APN	11	29795328	missense	possibly damaging	0.49
IGL03301:Eml6	APN	11	29764083	missense	probably benign	0.18
IGL03386:Eml6	APN	11	29749934	missense	probably benign
IGL03407:Eml6	APN	11	29906330	missense	probably damaging	1.00
PIT4453001:Eml6	UTSW	11	29802489	missense	probably damaging	1.00
R0125:Eml6	UTSW	11	29882088	missense	probably benign	0.19
R0240:Eml6	UTSW	11	29792367	missense	possibly damaging	0.84
R0240:Eml6	UTSW	11	29792367	missense	possibly damaging	0.84
R0271:Eml6	UTSW	11	29848949	missense	possibly damaging	0.48
R0304:Eml6	UTSW	11	29777441	missense	probably benign	0.00
R0415:Eml6	UTSW	11	29749392	missense	possibly damaging	0.84
R0449:Eml6	UTSW	11	29893213	missense	probably benign	0.01
R0538:Eml6	UTSW	11	29760010	splice site	probably benign
R0671:Eml6	UTSW	11	29805065	missense	probably benign	0.00
R0800:Eml6	UTSW	11	29749877	missense	probably benign	0.08
R0841:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R0879:Eml6	UTSW	11	29850816	critical splice donor site	probably null
R1061:Eml6	UTSW	11	29777267	missense	probably damaging	1.00
R1145:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R1145:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R1172:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1173:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1174:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1199:Eml6	UTSW	11	29755044	missense	possibly damaging	0.93
R1311:Eml6	UTSW	11	29831088	splice site	probably benign
R1312:Eml6	UTSW	11	29831219	splice site	probably benign
R1355:Eml6	UTSW	11	29833085	missense	probably benign	0.03
R1370:Eml6	UTSW	11	29833085	missense	probably benign	0.03
R1457:Eml6	UTSW	11	30024459	missense	probably damaging	1.00
R1486:Eml6	UTSW	11	29805114	missense	possibly damaging	0.83
R1511:Eml6	UTSW	11	29818374	missense	probably damaging	1.00
R1532:Eml6	UTSW	11	29792256	splice site	probably null
R1642:Eml6	UTSW	11	29777001	critical splice donor site	probably null
R1682:Eml6	UTSW	11	29759065	missense	probably benign	0.13
R1687:Eml6	UTSW	11	29833187	missense	probably damaging	1.00
R1699:Eml6	UTSW	11	29746282	nonsense	probably null
R1796:Eml6	UTSW	11	29881975	missense	probably benign	0.19
R1797:Eml6	UTSW	11	29882041	missense	probably benign	0.09
R1837:Eml6	UTSW	11	29749802	splice site	probably null
R1874:Eml6	UTSW	11	29831136	missense	probably damaging	0.99
R1967:Eml6	UTSW	11	30024545	missense	probably damaging	1.00
R1969:Eml6	UTSW	11	29833075	missense	probably benign
R2007:Eml6	UTSW	11	29848814	critical splice donor site	probably null
R2012:Eml6	UTSW	11	29831128	missense	possibly damaging	0.85
R2198:Eml6	UTSW	11	29850935	missense	probably benign	0.01
R2217:Eml6	UTSW	11	29818907	missense	probably damaging	1.00
R2218:Eml6	UTSW	11	29818907	missense	probably damaging	1.00
R2403:Eml6	UTSW	11	29802434	missense	probably benign	0.05
R2520:Eml6	UTSW	11	29791993	missense	probably damaging	1.00
R2937:Eml6	UTSW	11	29833049	splice site	probably benign
R2938:Eml6	UTSW	11	29833049	splice site	probably benign
R3085:Eml6	UTSW	11	29809332	missense	probably damaging	0.96
R3236:Eml6	UTSW	11	29831097	critical splice donor site	probably null
R3738:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R3739:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R3752:Eml6	UTSW	11	29809360	missense	probably benign	0.06
R3854:Eml6	UTSW	11	29749905	missense	possibly damaging	0.76
R3941:Eml6	UTSW	11	29803167	missense	probably damaging	0.98
R4034:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R4049:Eml6	UTSW	11	29838577	missense	probably damaging	1.00
R4108:Eml6	UTSW	11	29805136	missense	probably damaging	0.98
R4657:Eml6	UTSW	11	29805108	missense	possibly damaging	0.77
R4662:Eml6	UTSW	11	29777390	missense	probably damaging	1.00
R4665:Eml6	UTSW	11	29819007	nonsense	probably null
R4721:Eml6	UTSW	11	29838525	missense	possibly damaging	0.95
R4729:Eml6	UTSW	11	29833204	missense	probably damaging	1.00
R4766:Eml6	UTSW	11	29805757	missense	probably benign	0.22
R4810:Eml6	UTSW	11	29755011	missense	possibly damaging	0.92
R4831:Eml6	UTSW	11	29777052	nonsense	probably null
R5035:Eml6	UTSW	11	29854187	missense	probably benign	0.00
R5064:Eml6	UTSW	11	29749300	missense	probably benign	0.12
R5103:Eml6	UTSW	11	29850905	missense	possibly damaging	0.65
R5121:Eml6	UTSW	11	29744606	missense	probably benign	0.03
R5161:Eml6	UTSW	11	30024467	missense	probably damaging	0.99
R5211:Eml6	UTSW	11	29854145	missense	probably benign	0.02
R5268:Eml6	UTSW	11	29803108	missense	probably benign	0.15
R5390:Eml6	UTSW	11	29760096	missense	probably damaging	1.00
R5529:Eml6	UTSW	11	29764126	missense	probably benign	0.04
R6239:Eml6	UTSW	11	29749275	missense	probably damaging	1.00
R6326:Eml6	UTSW	11	29819066	missense	probably damaging	1.00
R6395:Eml6	UTSW	11	29809321	missense	probably benign	0.00
R6476:Eml6	UTSW	11	29791971	critical splice donor site	probably null
R6483:Eml6	UTSW	11	29749875	missense	probably benign	0.00
R6701:Eml6	UTSW	11	29785748	missense	probably damaging	0.98
R6753:Eml6	UTSW	11	29754987	missense	probably damaging	1.00
R6809:Eml6	UTSW	11	29803161	missense	probably benign	0.23
R6847:Eml6	UTSW	11	29818447	missense	probably benign	0.00
R6855:Eml6	UTSW	11	29751381	splice site	probably null
R7168:Eml6	UTSW	11	29838529	missense	probably benign	0.01
R7175:Eml6	UTSW	11	29784231	missense	probably benign	0.00
R7305:Eml6	UTSW	11	29777258	missense	probably benign	0.01
R7615:Eml6	UTSW	11	29802501	missense	possibly damaging	0.49
R7692:Eml6	UTSW	11	29753085	missense	probably damaging	0.98
R7980:Eml6	UTSW	11	29833205	missense	probably damaging	1.00
R8026:Eml6	UTSW	11	29749973	missense	possibly damaging	0.63
R8046:Eml6	UTSW	11	29758981	missense	probably damaging	0.99
R8049:Eml6	UTSW	11	29893201	missense	possibly damaging	0.95
R8114:Eml6	UTSW	11	29754910	missense	probably damaging	1.00
R8425:Eml6	UTSW	11	29755008	missense	probably benign	0.00
R8799:Eml6	UTSW	11	29758981	missense	probably benign	0.11
R8945:Eml6	UTSW	11	29753110	missense	probably damaging	0.98
R8977:Eml6	UTSW	11	29784182	missense	possibly damaging	0.59
R8986:Eml6	UTSW	11	29805181	missense	possibly damaging	0.92
R9088:Eml6	UTSW	11	29818424	missense	probably damaging	0.96
R9150:Eml6	UTSW	11	29805791	missense	probably benign	0.15
R9209:Eml6	UTSW	11	29831175	missense	probably damaging	1.00
R9288:Eml6	UTSW	11	29838641	critical splice acceptor site	probably null
RF037:Eml6	UTSW	11	29752549	critical splice acceptor site	probably benign
RF039:Eml6	UTSW	11	29752551	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- GGGGTCCAGGCTTTTATTCTCTCTTTAC -3'
(R):5'- GGACTTGACCACGACAGCCATT -3'

Sequencing Primer
(F):5'- ATTCTCTCTTTACTGACCTGGCG -3'
(R):5'- agaaaaaaaggaaaggaaggaagg -3'

Posted On

2013-09-30