Incidental Mutation 'R9152:Ap3b1'
ID 695110
Institutional Source Beutler Lab
Gene Symbol Ap3b1
Ensembl Gene ENSMUSG00000021686
Gene Name adaptor-related protein complex 3, beta 1 subunit
Synonyms recombination induced mutation 2, rim2, Hps2, beta3A, AP-3
MMRRC Submission
Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;
Essential gene? Possibly non essential (E-score: 0.441) question?
Stock # R9152 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 94358960-94566317 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 94472931 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022196] [ENSMUST00000022196]
AlphaFold Q9Z1T1
Predicted Effect probably null
Transcript: ENSMUST00000022196
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000022196
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231916
Meta Mutation Damage Score 0.9591 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A T 7: 140,297,343 N857I possibly damaging Het
Adamts6 C A 13: 104,476,767 R1009S probably benign Het
Akap13 T A 7: 75,611,285 I1219K probably damaging Het
Arsa G A 15: 89,475,792 probably benign Het
Clrn2 T C 5: 45,463,912 I216T probably benign Het
Cspg4 A G 9: 56,888,179 K1066R probably benign Het
Cul4a T C 8: 13,105,799 M15T probably benign Het
Defb38 C T 8: 19,026,542 probably benign Het
Dnah9 T C 11: 66,130,631 D323G probably damaging Het
Dsg1c T A 18: 20,283,272 D743E probably benign Het
Elf1 T C 14: 79,570,912 L268P probably damaging Het
Gm2056 T C 12: 88,027,176 L58P probably damaging Het
H2afy CTTACCTCCAGCT C 13: 56,084,191 probably null Het
Helq G T 5: 100,770,459 A863D probably benign Het
Hfm1 T A 5: 106,841,745 R1368S probably benign Het
Hspg2 G A 4: 137,522,565 G1379E possibly damaging Het
Kcnq5 A T 1: 21,469,468 probably null Het
Lrit2 C T 14: 37,072,230 T417I probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mgat2 G A 12: 69,185,723 W357* probably null Het
Mlkl A G 8: 111,319,771 L290P probably damaging Het
Olfr267 T C 4: 58,785,114 I203V probably benign Het
Olfr339 T A 2: 36,421,427 S10T possibly damaging Het
Olfr851 A T 9: 19,497,152 I135F probably damaging Het
Pcnx T C 12: 81,975,815 V853A Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pik3c2a G A 7: 116,417,769 S251L probably benign Het
Prkch T C 12: 73,691,644 M175T possibly damaging Het
Psg22 A T 7: 18,726,721 Q425L probably damaging Het
Qpctl A G 7: 19,149,100 L29P probably damaging Het
Ranbp10 A T 8: 105,772,508 L549M probably benign Het
Rbbp6 A G 7: 123,001,474 E1568G unknown Het
Rrh A T 3: 129,813,254 D173E probably benign Het
Selplg A G 5: 113,819,406 S280P probably benign Het
Sept11 T C 5: 93,139,470 S17P probably benign Het
Stard9 T C 2: 120,698,587 V1775A probably damaging Het
Tep1 A C 14: 50,866,705 V244G probably benign Het
Tex24 A C 8: 27,345,351 E302D possibly damaging Het
Trav18 A G 14: 53,831,554 T19A probably benign Het
Trim56 T C 5: 137,114,533 D43G probably benign Het
Trp53bp1 T C 2: 121,198,575 T1869A probably damaging Het
Usp22 A G 11: 61,158,375 C383R probably damaging Het
Zdhhc22 G A 12: 86,988,418 P87S probably benign Het
Other mutations in Ap3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Ap3b1 APN 13 94390863 missense probably damaging 1.00
IGL00766:Ap3b1 APN 13 94542884 splice site probably benign
IGL01784:Ap3b1 APN 13 94493739 missense probably damaging 1.00
IGL01979:Ap3b1 APN 13 94448463 nonsense probably null
IGL02040:Ap3b1 APN 13 94408845 critical splice donor site probably null
IGL02119:Ap3b1 APN 13 94462403 missense probably benign 0.01
IGL02247:Ap3b1 APN 13 94394795 critical splice donor site probably null
IGL02303:Ap3b1 APN 13 94528319 missense unknown
IGL02493:Ap3b1 APN 13 94404020 missense probably damaging 0.98
IGL02551:Ap3b1 APN 13 94418091 missense probably damaging 0.99
IGL02651:Ap3b1 APN 13 94477021 missense probably damaging 1.00
IGL02832:Ap3b1 APN 13 94528327 missense unknown
IGL03033:Ap3b1 APN 13 94448495 missense probably benign 0.15
IGL03101:Ap3b1 APN 13 94455398 missense probably benign 0.00
bella UTSW 13 94528257 missense unknown
bullet_gray UTSW 13 94451086 critical splice donor site probably benign
cuttlefish UTSW 13 94448451 critical splice acceptor site probably null
Gastropod UTSW 13 94542840 missense unknown
razor UTSW 13 94493731 missense unknown
Slime UTSW 13 94404078 missense possibly damaging 0.51
slug UTSW 13 94408845 critical splice donor site probably null
snail UTSW 13 94479885 splice site probably benign
stalk UTSW 13 94472931 critical splice donor site probably null
R0034:Ap3b1 UTSW 13 94479885 splice site probably benign
R0265:Ap3b1 UTSW 13 94493681 missense unknown
R0270:Ap3b1 UTSW 13 94404118 splice site probably benign
R0346:Ap3b1 UTSW 13 94445971 nonsense probably null
R0422:Ap3b1 UTSW 13 94462460 missense probably damaging 0.99
R0496:Ap3b1 UTSW 13 94472938 splice site probably benign
R0508:Ap3b1 UTSW 13 94565714 missense unknown
R0764:Ap3b1 UTSW 13 94479879 splice site probably benign
R1506:Ap3b1 UTSW 13 94446143 splice site probably benign
R1593:Ap3b1 UTSW 13 94501927 missense unknown
R1660:Ap3b1 UTSW 13 94408812 missense probably damaging 0.98
R1735:Ap3b1 UTSW 13 94493717 missense unknown
R1791:Ap3b1 UTSW 13 94408797 missense possibly damaging 0.63
R1818:Ap3b1 UTSW 13 94471704 missense possibly damaging 0.48
R2280:Ap3b1 UTSW 13 94528216 missense unknown
R3031:Ap3b1 UTSW 13 94565643 missense unknown
R3037:Ap3b1 UTSW 13 94445978 critical splice donor site probably null
R4401:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4402:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4403:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4532:Ap3b1 UTSW 13 94565735 missense unknown
R4624:Ap3b1 UTSW 13 94483226 missense unknown
R4626:Ap3b1 UTSW 13 94404078 missense possibly damaging 0.51
R4754:Ap3b1 UTSW 13 94403960 missense probably damaging 1.00
R4788:Ap3b1 UTSW 13 94565641 missense unknown
R4847:Ap3b1 UTSW 13 94471779 missense probably benign 0.15
R4886:Ap3b1 UTSW 13 94472805 missense possibly damaging 0.50
R5096:Ap3b1 UTSW 13 94479849 missense unknown
R5628:Ap3b1 UTSW 13 94477048 missense unknown
R5671:Ap3b1 UTSW 13 94528257 missense unknown
R5677:Ap3b1 UTSW 13 94528196 missense unknown
R5862:Ap3b1 UTSW 13 94547770 missense unknown
R5941:Ap3b1 UTSW 13 94440273 missense probably benign 0.02
R5941:Ap3b1 UTSW 13 94483265 missense probably damaging 0.96
R6043:Ap3b1 UTSW 13 94476993 missense probably benign 0.09
R6212:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R6212:Ap3b1 UTSW 13 94493699 missense unknown
R6301:Ap3b1 UTSW 13 94528295 missense unknown
R6765:Ap3b1 UTSW 13 94462509 missense probably benign 0.02
R6812:Ap3b1 UTSW 13 94479861 missense unknown
R6888:Ap3b1 UTSW 13 94408791 missense probably benign 0.42
R6901:Ap3b1 UTSW 13 94418142 missense probably benign 0.00
R7157:Ap3b1 UTSW 13 94532034 nonsense probably null
R7422:Ap3b1 UTSW 13 94528165 missense unknown
R7642:Ap3b1 UTSW 13 94477032 missense probably benign 0.19
R7710:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R7757:Ap3b1 UTSW 13 94528158 splice site probably null
R7867:Ap3b1 UTSW 13 94483263 missense unknown
R8492:Ap3b1 UTSW 13 94394786 missense possibly damaging 0.60
R8706:Ap3b1 UTSW 13 94408845 critical splice donor site probably null
R8749:Ap3b1 UTSW 13 94528217 missense unknown
R8876:Ap3b1 UTSW 13 94404078 missense possibly damaging 0.51
R8889:Ap3b1 UTSW 13 94542840 missense unknown
R8892:Ap3b1 UTSW 13 94542840 missense unknown
R9065:Ap3b1 UTSW 13 94471715 missense probably damaging 1.00
R9152:Ap3b1 UTSW 13 94493731 missense unknown
R9166:Ap3b1 UTSW 13 94471728 missense probably damaging 1.00
R9218:Ap3b1 UTSW 13 94448451 critical splice acceptor site probably null
R9269:Ap3b1 UTSW 13 94404062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGAGCTCTGATATGATTGTCATC -3'
(R):5'- CCTTGAAGCAGAGAACAGTGC -3'

Sequencing Primer
(F):5'- AGATAGGGATCGCTTCCA -3'
(R):5'- ACAGTGCAGGTACAGCGGC -3'
Posted On 2022-01-20