Incidental Mutation 'R9153:Myo3a'
ID 695120
Institutional Source Beutler Lab
Gene Symbol Myo3a
Ensembl Gene ENSMUSG00000025716
Gene Name myosin IIIA
Synonyms 9030416P08Rik
Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9153 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 22227503-22618252 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22399933 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 700 (N700S)
Ref Sequence ENSEMBL: ENSMUSP00000046329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000153002]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044749
AA Change: N700S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: N700S

DomainStartEndE-ValueType
S_TKc 29 295 1.62e-91 SMART
MYSc 340 1061 2.07e-252 SMART
IQ 1061 1083 2.88e1 SMART
IQ 1088 1110 9.48e-3 SMART
low complexity region 1153 1169 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
low complexity region 1496 1505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153002
AA Change: N692S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000120573
Gene: ENSMUSG00000025716
AA Change: N692S

DomainStartEndE-ValueType
S_TKc 21 287 1.62e-91 SMART
MYSc 332 753 3.06e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,216,655 S711R possibly damaging Het
Adnp C A 2: 168,184,660 Q238H possibly damaging Het
Akap13 A G 7: 75,609,481 T618A probably benign Het
Ankfn1 G A 11: 89,412,019 R58W probably damaging Het
Armc4 T C 18: 7,286,733 K166R possibly damaging Het
Borcs5 G T 6: 134,641,145 probably benign Het
C1s1 T C 6: 124,540,947 M25V possibly damaging Het
Canx A T 11: 50,297,335 D527E probably benign Het
Ccdc154 G A 17: 25,163,178 D24N probably damaging Het
Ccnt1 G A 15: 98,543,278 T703I probably benign Het
Cd46 T C 1: 195,092,171 S19G possibly damaging Het
Cdc25b G A 2: 131,192,644 E264K possibly damaging Het
Cog5 A C 12: 31,660,811 K63N possibly damaging Het
Col28a1 G A 6: 8,022,765 T726I probably benign Het
Dhx40 A G 11: 86,799,539 S219P probably damaging Het
Dnah12 T A 14: 26,814,612 W2162R probably damaging Het
Eef1a2 A G 2: 181,147,981 *464R probably null Het
Eif1a T A 18: 46,607,969 D90E probably damaging Het
Fasn C T 11: 120,815,670 R996Q possibly damaging Het
Foxred2 A G 15: 77,955,587 probably null Het
Frat2 A G 19: 41,847,367 L182P probably damaging Het
Fxyd2 G T 9: 45,408,311 V24F probably damaging Het
Gabrd C T 4: 155,386,039 V319I probably damaging Het
Gm28710 A T 5: 16,835,918 probably null Het
H13 T G 2: 152,691,868 V267G possibly damaging Het
Hnf4g T C 3: 3,508,318 probably benign Het
Iglon5 T A 7: 43,475,997 T272S possibly damaging Het
Iqgap2 T A 13: 95,708,039 M454L probably benign Het
Irf8 T C 8: 120,753,661 C304R probably benign Het
Itga2 A G 13: 114,865,405 F614L probably benign Het
Itgb4 A C 11: 115,984,053 H412P probably benign Het
Jarid2 T C 13: 44,911,202 F921S probably damaging Het
Kctd13 A G 7: 126,942,155 D189G probably damaging Het
Meis2 G T 2: 115,867,275 P381T probably benign Het
Mertk G T 2: 128,782,567 A633S probably damaging Het
Morn5 A G 2: 36,052,981 Y31C probably damaging Het
Mug2 A T 6: 122,040,668 T455S possibly damaging Het
Nisch T C 14: 31,174,825 T807A unknown Het
Nkx1-1 A T 5: 33,431,359 V195E unknown Het
Numa1 A G 7: 101,999,911 T950A probably benign Het
Nup160 A G 2: 90,684,085 T126A possibly damaging Het
Oca2 C T 7: 56,293,838 T253I probably benign Het
Olfr799 T A 10: 129,647,437 I103N possibly damaging Het
P4ha1 A G 10: 59,367,290 K435R probably damaging Het
Pcdhgb4 T A 18: 37,721,078 N175K possibly damaging Het
Phactr3 A T 2: 178,283,946 E338V possibly damaging Het
Plec G T 15: 76,180,525 R1782S unknown Het
Prpf39 A T 12: 65,059,897 Q593L probably damaging Het
Ptprq T C 10: 107,580,265 Y1724C probably damaging Het
Pygo1 T A 9: 72,944,861 V110D possibly damaging Het
Rasgrf1 T A 9: 89,944,737 L133Q probably damaging Het
Rgs10 G A 7: 128,374,009 R145C probably damaging Het
Secisbp2 A G 13: 51,679,819 Y665C possibly damaging Het
Sel1l3 T A 5: 53,135,846 T843S probably benign Het
Senp7 G A 16: 56,186,123 V964I probably benign Het
Setd4 T A 16: 93,587,834 D322V possibly damaging Het
Sftpc T A 14: 70,522,210 T90S probably benign Het
Shq1 A T 6: 100,611,777 D382E probably damaging Het
Sim1 A G 10: 50,895,933 R13G probably damaging Het
Slc27a6 T C 18: 58,598,733 F385S probably benign Het
Stk38l A G 6: 146,758,550 T27A probably benign Het
Tasp1 A G 2: 140,057,407 S9P probably damaging Het
Tcstv1 T A 13: 119,893,754 D114V probably damaging Het
Tmigd1 A T 11: 76,904,642 R25S probably benign Het
Tnrc6a T A 7: 123,174,296 Y1154N probably damaging Het
Tox2 T C 2: 163,203,171 V3A Het
Ubr1 A T 2: 120,925,988 D719E probably benign Het
Ubr3 A G 2: 69,965,478 K923R Het
Vmn2r12 C T 5: 109,086,337 V670M probably damaging Het
Zfp983 T C 17: 21,657,606 S9P probably benign Het
Zfp986 A T 4: 145,899,460 H230L probably damaging Het
Zscan4f G A 7: 11,401,314 E216K probably benign Het
Other mutations in Myo3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Myo3a APN 2 22332473 missense probably benign 0.42
IGL01307:Myo3a APN 2 22558289 missense probably damaging 1.00
IGL01413:Myo3a APN 2 22297600 missense probably benign 0.25
IGL01655:Myo3a APN 2 22423326 missense probably damaging 1.00
IGL01767:Myo3a APN 2 22423222 missense probably damaging 0.96
IGL01803:Myo3a APN 2 22241115 missense probably damaging 1.00
IGL01969:Myo3a APN 2 22297688 missense probably benign 0.03
IGL02043:Myo3a APN 2 22399965 missense probably benign 0.01
IGL02124:Myo3a APN 2 22577526 missense probably benign 0.01
IGL02174:Myo3a APN 2 22332393 missense probably benign 0.04
IGL02649:Myo3a APN 2 22323607 missense probably benign
IGL02976:Myo3a APN 2 22542452 nonsense probably null
IGL03328:Myo3a APN 2 22578198 missense probably benign 0.02
IGL03376:Myo3a APN 2 22600074 splice site probably benign
lose UTSW 2 22558320 nonsense probably null
snooze UTSW 2 22282634 missense probably damaging 0.99
A5278:Myo3a UTSW 2 22323653 missense probably benign 0.27
PIT4445001:Myo3a UTSW 2 22542415 missense possibly damaging 0.64
R0008:Myo3a UTSW 2 22579741 missense probably damaging 0.99
R0099:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0212:Myo3a UTSW 2 22291848 missense probably damaging 1.00
R0281:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0282:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0492:Myo3a UTSW 2 22323636 missense possibly damaging 0.46
R0498:Myo3a UTSW 2 22577429 missense possibly damaging 0.74
R0594:Myo3a UTSW 2 22544332 splice site probably benign
R0609:Myo3a UTSW 2 22333513 missense probably benign 0.29
R0609:Myo3a UTSW 2 22396299 missense possibly damaging 0.95
R0827:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R0968:Myo3a UTSW 2 22558289 missense probably damaging 1.00
R1157:Myo3a UTSW 2 22542414 critical splice acceptor site probably null
R1301:Myo3a UTSW 2 22267095 splice site probably benign
R1352:Myo3a UTSW 2 22323675 critical splice donor site probably null
R1443:Myo3a UTSW 2 22282626 missense probably damaging 0.99
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1517:Myo3a UTSW 2 22282634 missense probably damaging 0.99
R1565:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1712:Myo3a UTSW 2 22564992 missense probably damaging 1.00
R1722:Myo3a UTSW 2 22399827 missense probably benign 0.03
R1822:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1823:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1824:Myo3a UTSW 2 22396243 missense probably benign
R1837:Myo3a UTSW 2 22577592 missense possibly damaging 0.76
R1867:Myo3a UTSW 2 22399846 missense probably benign 0.00
R1917:Myo3a UTSW 2 22291922 missense probably damaging 1.00
R1920:Myo3a UTSW 2 22564996 missense probably benign 0.02
R1937:Myo3a UTSW 2 22396315 missense probably damaging 1.00
R1954:Myo3a UTSW 2 22241226 missense probably damaging 1.00
R1988:Myo3a UTSW 2 22578128 missense possibly damaging 0.86
R2091:Myo3a UTSW 2 22333677 missense probably damaging 0.99
R2115:Myo3a UTSW 2 22245531 missense probably damaging 1.00
R2125:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2126:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2216:Myo3a UTSW 2 22577771 missense probably benign 0.00
R2413:Myo3a UTSW 2 22577912 missense probably benign 0.00
R2964:Myo3a UTSW 2 22340256 missense possibly damaging 0.90
R3196:Myo3a UTSW 2 22399868 missense possibly damaging 0.86
R3837:Myo3a UTSW 2 22565109 splice site probably benign
R3905:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R3926:Myo3a UTSW 2 22565041 missense probably damaging 0.99
R4014:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4015:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4017:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4043:Myo3a UTSW 2 22333539 splice site probably benign
R4044:Myo3a UTSW 2 22577700 missense probably damaging 0.99
R4057:Myo3a UTSW 2 22266160 missense probably benign 0.01
R4192:Myo3a UTSW 2 22407377 missense probably damaging 1.00
R4282:Myo3a UTSW 2 22340278 missense probably benign 0.14
R4321:Myo3a UTSW 2 22267155 missense probably damaging 1.00
R4393:Myo3a UTSW 2 22577854 missense probably damaging 0.99
R4398:Myo3a UTSW 2 22577842 missense probably benign
R4446:Myo3a UTSW 2 22600137 missense probably damaging 1.00
R4685:Myo3a UTSW 2 22407422 missense probably damaging 1.00
R5032:Myo3a UTSW 2 22282602 missense probably damaging 1.00
R5096:Myo3a UTSW 2 22574242 missense probably benign 0.16
R5183:Myo3a UTSW 2 22578158 missense probably benign 0.05
R5458:Myo3a UTSW 2 22245550 missense probably damaging 1.00
R5502:Myo3a UTSW 2 22558369 missense probably damaging 1.00
R5522:Myo3a UTSW 2 22574341 missense probably damaging 1.00
R6462:Myo3a UTSW 2 22558411 missense probably damaging 1.00
R6479:Myo3a UTSW 2 22577865 missense probably benign 0.00
R6513:Myo3a UTSW 2 22407332 missense probably damaging 1.00
R6520:Myo3a UTSW 2 22399926 missense possibly damaging 0.90
R6602:Myo3a UTSW 2 22577787 missense probably damaging 0.96
R6671:Myo3a UTSW 2 22294522 missense probably damaging 1.00
R6743:Myo3a UTSW 2 22361664 missense probably benign 0.24
R6865:Myo3a UTSW 2 22574301 missense probably benign 0.00
R6961:Myo3a UTSW 2 22245558 missense probably benign 0.00
R7001:Myo3a UTSW 2 22332377 missense probably benign 0.04
R7215:Myo3a UTSW 2 22245567 missense possibly damaging 0.78
R7301:Myo3a UTSW 2 22544466 critical splice donor site probably null
R7318:Myo3a UTSW 2 22558320 nonsense probably null
R7447:Myo3a UTSW 2 22544426 missense probably benign 0.27
R7456:Myo3a UTSW 2 22407444 missense probably benign 0.08
R7528:Myo3a UTSW 2 22266114 nonsense probably null
R7731:Myo3a UTSW 2 22282589 missense probably damaging 1.00
R7768:Myo3a UTSW 2 22241143 missense probably damaging 0.99
R8054:Myo3a UTSW 2 22574317 missense probably benign 0.00
R8140:Myo3a UTSW 2 22407346 missense probably damaging 1.00
R8143:Myo3a UTSW 2 22282665 critical splice donor site probably null
R8346:Myo3a UTSW 2 22558422 critical splice donor site probably null
R8421:Myo3a UTSW 2 22362124 missense probably benign 0.07
R8495:Myo3a UTSW 2 22396273 missense probably damaging 0.96
R8551:Myo3a UTSW 2 22332466 missense probably benign 0.00
R8708:Myo3a UTSW 2 22291796 splice site probably benign
R8757:Myo3a UTSW 2 22558307 missense possibly damaging 0.49
R8759:Myo3a UTSW 2 22558307 missense possibly damaging 0.49
R8779:Myo3a UTSW 2 22245593 nonsense probably null
R8828:Myo3a UTSW 2 22241053 missense probably benign 0.01
R8910:Myo3a UTSW 2 22574268 missense probably benign 0.01
R8916:Myo3a UTSW 2 22567692 missense probably damaging 1.00
R8926:Myo3a UTSW 2 22396263 missense possibly damaging 0.95
R9028:Myo3a UTSW 2 22600087 missense possibly damaging 0.79
R9046:Myo3a UTSW 2 22558355 missense probably damaging 0.99
R9120:Myo3a UTSW 2 22544426 missense probably benign 0.27
R9191:Myo3a UTSW 2 22579829 missense probably benign 0.24
R9258:Myo3a UTSW 2 22577533 missense possibly damaging 0.60
R9436:Myo3a UTSW 2 22407424
Z1177:Myo3a UTSW 2 22618140 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AATGTCAAATGCTGCCGTTCC -3'
(R):5'- AATGTGATGGCGCTACTAAAAG -3'

Sequencing Primer
(F):5'- AAATGCTGCCGTTCCATTTAG -3'
(R):5'- TGTGATGGCGCTACTAAAAGATAAAC -3'
Posted On 2022-01-20