Incidental Mutation 'R9153:Ubr1'
ID 695125
Institutional Source Beutler Lab
Gene Symbol Ubr1
Ensembl Gene ENSMUSG00000027272
Gene Name ubiquitin protein ligase E3 component n-recognin 1
Synonyms E3 alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.850) question?
Stock # R9153 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120860269-120970715 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120925988 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 719 (D719E)
Ref Sequence ENSEMBL: ENSMUSP00000028728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028728]
AlphaFold O70481
Predicted Effect probably benign
Transcript: ENSMUST00000028728
AA Change: D719E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: D719E

DomainStartEndE-ValueType
ZnF_UBR1 97 167 1.24e-35 SMART
Pfam:ClpS 221 301 8e-24 PFAM
low complexity region 918 936 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1070 1081 N/A INTRINSIC
Blast:RING 1101 1203 4e-34 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,216,655 S711R possibly damaging Het
Adnp C A 2: 168,184,660 Q238H possibly damaging Het
Akap13 A G 7: 75,609,481 T618A probably benign Het
Ankfn1 G A 11: 89,412,019 R58W probably damaging Het
Armc4 T C 18: 7,286,733 K166R possibly damaging Het
Atp8b5 A G 4: 43,308,493 probably benign Het
Borcs5 G T 6: 134,641,145 probably benign Het
C1s1 T C 6: 124,540,947 M25V possibly damaging Het
Canx A T 11: 50,297,335 D527E probably benign Het
Ccdc154 G A 17: 25,163,178 D24N probably damaging Het
Ccnt1 G A 15: 98,543,278 T703I probably benign Het
Cd46 T C 1: 195,092,171 S19G possibly damaging Het
Cdc25b G A 2: 131,192,644 E264K possibly damaging Het
Cog5 A C 12: 31,660,811 K63N possibly damaging Het
Col28a1 G A 6: 8,022,765 T726I probably benign Het
Dhx40 A G 11: 86,799,539 S219P probably damaging Het
Dnah12 T A 14: 26,814,612 W2162R probably damaging Het
Eef1a2 A G 2: 181,147,981 *464R probably null Het
Eif1a T A 18: 46,607,969 D90E probably damaging Het
Fasn C T 11: 120,815,670 R996Q possibly damaging Het
Foxred2 A G 15: 77,955,587 probably null Het
Frat2 A G 19: 41,847,367 L182P probably damaging Het
Fxyd2 G T 9: 45,408,311 V24F probably damaging Het
Gabrd C T 4: 155,386,039 V319I probably damaging Het
Gm28710 A T 5: 16,835,918 probably null Het
H13 T G 2: 152,691,868 V267G possibly damaging Het
Hnf4g T C 3: 3,508,318 probably benign Het
Iglon5 T A 7: 43,475,997 T272S possibly damaging Het
Iqgap2 T A 13: 95,708,039 M454L probably benign Het
Irf8 T C 8: 120,753,661 C304R probably benign Het
Itga2 A G 13: 114,865,405 F614L probably benign Het
Itgb4 A C 11: 115,984,053 H412P probably benign Het
Jarid2 T C 13: 44,911,202 F921S probably damaging Het
Kctd13 A G 7: 126,942,155 D189G probably damaging Het
Meis2 G T 2: 115,867,275 P381T probably benign Het
Mertk G T 2: 128,782,567 A633S probably damaging Het
Morn5 A G 2: 36,052,981 Y31C probably damaging Het
Mug2 A T 6: 122,040,668 T455S possibly damaging Het
Myo3a A G 2: 22,399,933 N700S probably benign Het
Nisch T C 14: 31,174,825 T807A unknown Het
Nkx1-1 A T 5: 33,431,359 V195E unknown Het
Numa1 A G 7: 101,999,911 T950A probably benign Het
Nup160 A G 2: 90,684,085 T126A possibly damaging Het
Oca2 C T 7: 56,293,838 T253I probably benign Het
Olfr799 T A 10: 129,647,437 I103N possibly damaging Het
P4ha1 A G 10: 59,367,290 K435R probably damaging Het
Pcdhgb4 T A 18: 37,721,078 N175K possibly damaging Het
Per3 A G 4: 151,027,339 L396P probably benign Het
Phactr3 A T 2: 178,283,946 E338V possibly damaging Het
Plec G T 15: 76,180,525 R1782S unknown Het
Prpf39 A T 12: 65,059,897 Q593L probably damaging Het
Ptprq T C 10: 107,580,265 Y1724C probably damaging Het
Pygo1 T A 9: 72,944,861 V110D possibly damaging Het
Rasgrf1 T A 9: 89,944,737 L133Q probably damaging Het
Rgs10 G A 7: 128,374,009 R145C probably damaging Het
Secisbp2 A G 13: 51,679,819 Y665C possibly damaging Het
Sel1l3 T A 5: 53,135,846 T843S probably benign Het
Senp7 G A 16: 56,186,123 V964I probably benign Het
Setd4 T A 16: 93,587,834 D322V possibly damaging Het
Sftpc T A 14: 70,522,210 T90S probably benign Het
Shq1 A T 6: 100,611,777 D382E probably damaging Het
Sim1 A G 10: 50,895,933 R13G probably damaging Het
Slc12a1 T G 2: 125,161,069 probably benign Het
Slc27a6 T C 18: 58,598,733 F385S probably benign Het
Stk38l A G 6: 146,758,550 T27A probably benign Het
Tasp1 A G 2: 140,057,407 S9P probably damaging Het
Tcstv1 T A 13: 119,893,754 D114V probably damaging Het
Tmigd1 A T 11: 76,904,642 R25S probably benign Het
Tnrc6a T A 7: 123,174,296 Y1154N probably damaging Het
Tox2 T C 2: 163,203,171 V3A Het
Ubr3 A G 2: 69,965,478 K923R Het
Vmn2r12 C T 5: 109,086,337 V670M probably damaging Het
Zfp983 T C 17: 21,657,606 S9P probably benign Het
Zfp986 A T 4: 145,899,460 H230L probably damaging Het
Zscan4f G A 7: 11,401,314 E216K probably benign Het
Other mutations in Ubr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ubr1 APN 2 120875407 missense possibly damaging 0.65
IGL00570:Ubr1 APN 2 120941093 missense possibly damaging 0.93
IGL00990:Ubr1 APN 2 120930872 missense probably damaging 1.00
IGL01124:Ubr1 APN 2 120914905 missense probably benign
IGL01346:Ubr1 APN 2 120873122 critical splice donor site probably null
IGL01368:Ubr1 APN 2 120941131 splice site probably benign
IGL01539:Ubr1 APN 2 120926013 missense possibly damaging 0.79
IGL01862:Ubr1 APN 2 120934342 missense possibly damaging 0.81
IGL01965:Ubr1 APN 2 120875398 missense probably damaging 0.99
IGL01984:Ubr1 APN 2 120921386 missense probably damaging 0.99
IGL02184:Ubr1 APN 2 120900508 missense probably benign 0.00
IGL02208:Ubr1 APN 2 120946349 missense probably benign 0.00
IGL02415:Ubr1 APN 2 120970603 utr 5 prime probably benign
IGL02517:Ubr1 APN 2 120864373 missense possibly damaging 0.69
IGL02614:Ubr1 APN 2 120870979 splice site probably benign
IGL02627:Ubr1 APN 2 120940991 missense probably damaging 1.00
IGL02718:Ubr1 APN 2 120914883 missense probably damaging 1.00
IGL02741:Ubr1 APN 2 120941091 missense probably benign 0.01
IGL02939:Ubr1 APN 2 120881183 critical splice acceptor site probably null
IGL03081:Ubr1 APN 2 120961156 missense possibly damaging 0.83
IGL03310:Ubr1 APN 2 120864417 missense probably damaging 1.00
IGL03370:Ubr1 APN 2 120895160 missense probably benign
I1329:Ubr1 UTSW 2 120934294 splice site probably benign
R0022:Ubr1 UTSW 2 120961173 splice site probably benign
R0345:Ubr1 UTSW 2 120904103 splice site probably null
R0373:Ubr1 UTSW 2 120946657 missense probably benign 0.01
R0393:Ubr1 UTSW 2 120906946 missense probably damaging 1.00
R0543:Ubr1 UTSW 2 120881093 missense probably damaging 1.00
R0559:Ubr1 UTSW 2 120947883 nonsense probably null
R0723:Ubr1 UTSW 2 120881101 nonsense probably null
R1178:Ubr1 UTSW 2 120926029 nonsense probably null
R1401:Ubr1 UTSW 2 120955644 missense probably benign 0.01
R1485:Ubr1 UTSW 2 120961098 missense probably benign 0.03
R1572:Ubr1 UTSW 2 120935319 splice site probably benign
R1920:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1921:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1997:Ubr1 UTSW 2 120946273 critical splice donor site probably null
R2129:Ubr1 UTSW 2 120942553 missense probably benign 0.35
R2147:Ubr1 UTSW 2 120864330 missense probably damaging 1.00
R2191:Ubr1 UTSW 2 120926047 missense probably damaging 0.96
R2288:Ubr1 UTSW 2 120909482 missense probably damaging 1.00
R3409:Ubr1 UTSW 2 120963448 missense probably benign 0.02
R3930:Ubr1 UTSW 2 120916470 missense probably benign 0.20
R3979:Ubr1 UTSW 2 120862687 missense probably benign 0.11
R4172:Ubr1 UTSW 2 120946622 splice site probably null
R4173:Ubr1 UTSW 2 120946622 splice site probably null
R4174:Ubr1 UTSW 2 120946622 splice site probably null
R4241:Ubr1 UTSW 2 120934386 missense possibly damaging 0.69
R4366:Ubr1 UTSW 2 120970603 utr 5 prime probably benign
R4371:Ubr1 UTSW 2 120895066 splice site probably null
R4449:Ubr1 UTSW 2 120946381 missense possibly damaging 0.84
R4533:Ubr1 UTSW 2 120942482 missense possibly damaging 0.86
R4656:Ubr1 UTSW 2 120926013 missense probably benign 0.35
R4765:Ubr1 UTSW 2 120963442 nonsense probably null
R4928:Ubr1 UTSW 2 120914938 missense probably damaging 1.00
R4987:Ubr1 UTSW 2 120963566 missense probably benign 0.00
R5033:Ubr1 UTSW 2 120911997 critical splice donor site probably null
R5108:Ubr1 UTSW 2 120963422 missense probably benign 0.20
R5118:Ubr1 UTSW 2 120882264 missense probably benign 0.20
R5211:Ubr1 UTSW 2 120893170 missense possibly damaging 0.92
R5215:Ubr1 UTSW 2 120904044 missense probably benign 0.00
R5449:Ubr1 UTSW 2 120963500 missense probably benign
R5452:Ubr1 UTSW 2 120868302 missense possibly damaging 0.95
R5582:Ubr1 UTSW 2 120915407 missense probably benign
R5610:Ubr1 UTSW 2 120892112 missense probably benign 0.04
R5637:Ubr1 UTSW 2 120963517 missense possibly damaging 0.68
R5808:Ubr1 UTSW 2 120961092 missense possibly damaging 0.63
R5845:Ubr1 UTSW 2 120904005 missense probably benign
R5979:Ubr1 UTSW 2 120946382 missense probably benign 0.07
R6044:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R6146:Ubr1 UTSW 2 120893209 missense probably damaging 0.98
R6252:Ubr1 UTSW 2 120906895 missense probably benign 0.21
R6389:Ubr1 UTSW 2 120881039 missense probably benign 0.03
R6600:Ubr1 UTSW 2 120915399 missense probably benign 0.00
R6670:Ubr1 UTSW 2 120924130 critical splice donor site probably null
R6731:Ubr1 UTSW 2 120955640 missense probably null 0.99
R6836:Ubr1 UTSW 2 120896675 splice site probably null
R6994:Ubr1 UTSW 2 120963593 missense probably benign
R7121:Ubr1 UTSW 2 120875498 missense probably benign 0.00
R7204:Ubr1 UTSW 2 120904077 missense possibly damaging 0.49
R7209:Ubr1 UTSW 2 120862765 missense probably benign 0.04
R7434:Ubr1 UTSW 2 120862680 missense probably benign
R7457:Ubr1 UTSW 2 120917828 missense probably benign 0.35
R7464:Ubr1 UTSW 2 120889774 critical splice donor site probably null
R7519:Ubr1 UTSW 2 120875444 missense possibly damaging 0.63
R7574:Ubr1 UTSW 2 120873191 missense possibly damaging 0.93
R8030:Ubr1 UTSW 2 120934374 missense probably damaging 0.99
R8085:Ubr1 UTSW 2 120934417 nonsense probably null
R8221:Ubr1 UTSW 2 120961104 missense probably damaging 0.97
R8241:Ubr1 UTSW 2 120963456 missense possibly damaging 0.80
R8291:Ubr1 UTSW 2 120911115 missense probably benign
R8293:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R8420:Ubr1 UTSW 2 120870995 missense probably benign
R8489:Ubr1 UTSW 2 120881067 missense probably benign 0.42
R8708:Ubr1 UTSW 2 120866483 missense probably benign 0.27
R8856:Ubr1 UTSW 2 120904042 missense probably damaging 1.00
R8995:Ubr1 UTSW 2 120866553 missense probably damaging 1.00
R9155:Ubr1 UTSW 2 120924134 missense possibly damaging 0.84
R9156:Ubr1 UTSW 2 120873122 critical splice donor site probably null
R9194:Ubr1 UTSW 2 120947844 missense probably damaging 1.00
R9320:Ubr1 UTSW 2 120896519 missense probably benign 0.04
R9401:Ubr1 UTSW 2 120935284 missense probably benign 0.06
R9430:Ubr1 UTSW 2 120904025 missense possibly damaging 0.59
R9515:Ubr1 UTSW 2 120873146 missense probably damaging 1.00
R9623:Ubr1 UTSW 2 120934339 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGAGTGACTGTATAGTACTGTTTGC -3'
(R):5'- CCATTAACTGAACATGGTAGCATAG -3'

Sequencing Primer
(F):5'- ACTGTTTGCACATTAATACAGACAC -3'
(R):5'- AACTGAACATGGTAGCATAGAAATAG -3'
Posted On 2022-01-20