Incidental Mutation 'R9153:Mertk'
ID 695126
Institutional Source Beutler Lab
Gene Symbol Mertk
Ensembl Gene ENSMUSG00000014361
Gene Name c-mer proto-oncogene tyrosine kinase
Synonyms Nyk, nmf12, Tyro 12, Eyk, Mer
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock # R9153 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 128698956-128802894 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 128782567 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 633 (A633S)
Ref Sequence ENSEMBL: ENSMUSP00000014505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014505]
AlphaFold Q60805
Predicted Effect probably damaging
Transcript: ENSMUST00000014505
AA Change: A633S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: A633S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 94 189 8.99e-6 SMART
IG 198 276 1.54e-4 SMART
FN3 279 363 7.23e-8 SMART
FN3 379 465 6.16e-2 SMART
transmembrane domain 498 520 N/A INTRINSIC
TyrKc 582 849 2.88e-129 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,216,655 S711R possibly damaging Het
Adnp C A 2: 168,184,660 Q238H possibly damaging Het
Akap13 A G 7: 75,609,481 T618A probably benign Het
Ankfn1 G A 11: 89,412,019 R58W probably damaging Het
Armc4 T C 18: 7,286,733 K166R possibly damaging Het
Borcs5 G T 6: 134,641,145 probably benign Het
C1s1 T C 6: 124,540,947 M25V possibly damaging Het
Canx A T 11: 50,297,335 D527E probably benign Het
Ccdc154 G A 17: 25,163,178 D24N probably damaging Het
Ccnt1 G A 15: 98,543,278 T703I probably benign Het
Cd46 T C 1: 195,092,171 S19G possibly damaging Het
Cdc25b G A 2: 131,192,644 E264K possibly damaging Het
Cog5 A C 12: 31,660,811 K63N possibly damaging Het
Col28a1 G A 6: 8,022,765 T726I probably benign Het
Dhx40 A G 11: 86,799,539 S219P probably damaging Het
Dnah12 T A 14: 26,814,612 W2162R probably damaging Het
Eef1a2 A G 2: 181,147,981 *464R probably null Het
Eif1a T A 18: 46,607,969 D90E probably damaging Het
Fasn C T 11: 120,815,670 R996Q possibly damaging Het
Foxred2 A G 15: 77,955,587 probably null Het
Frat2 A G 19: 41,847,367 L182P probably damaging Het
Fxyd2 G T 9: 45,408,311 V24F probably damaging Het
Gabrd C T 4: 155,386,039 V319I probably damaging Het
Gm28710 A T 5: 16,835,918 probably null Het
H13 T G 2: 152,691,868 V267G possibly damaging Het
Hnf4g T C 3: 3,508,318 probably benign Het
Iglon5 T A 7: 43,475,997 T272S possibly damaging Het
Iqgap2 T A 13: 95,708,039 M454L probably benign Het
Irf8 T C 8: 120,753,661 C304R probably benign Het
Itga2 A G 13: 114,865,405 F614L probably benign Het
Itgb4 A C 11: 115,984,053 H412P probably benign Het
Jarid2 T C 13: 44,911,202 F921S probably damaging Het
Kctd13 A G 7: 126,942,155 D189G probably damaging Het
Meis2 G T 2: 115,867,275 P381T probably benign Het
Morn5 A G 2: 36,052,981 Y31C probably damaging Het
Mug2 A T 6: 122,040,668 T455S possibly damaging Het
Myo3a A G 2: 22,399,933 N700S probably benign Het
Nisch T C 14: 31,174,825 T807A unknown Het
Nkx1-1 A T 5: 33,431,359 V195E unknown Het
Numa1 A G 7: 101,999,911 T950A probably benign Het
Nup160 A G 2: 90,684,085 T126A possibly damaging Het
Oca2 C T 7: 56,293,838 T253I probably benign Het
Olfr799 T A 10: 129,647,437 I103N possibly damaging Het
P4ha1 A G 10: 59,367,290 K435R probably damaging Het
Pcdhgb4 T A 18: 37,721,078 N175K possibly damaging Het
Phactr3 A T 2: 178,283,946 E338V possibly damaging Het
Plec G T 15: 76,180,525 R1782S unknown Het
Prpf39 A T 12: 65,059,897 Q593L probably damaging Het
Ptprq T C 10: 107,580,265 Y1724C probably damaging Het
Pygo1 T A 9: 72,944,861 V110D possibly damaging Het
Rasgrf1 T A 9: 89,944,737 L133Q probably damaging Het
Rgs10 G A 7: 128,374,009 R145C probably damaging Het
Secisbp2 A G 13: 51,679,819 Y665C possibly damaging Het
Sel1l3 T A 5: 53,135,846 T843S probably benign Het
Senp7 G A 16: 56,186,123 V964I probably benign Het
Setd4 T A 16: 93,587,834 D322V possibly damaging Het
Sftpc T A 14: 70,522,210 T90S probably benign Het
Shq1 A T 6: 100,611,777 D382E probably damaging Het
Sim1 A G 10: 50,895,933 R13G probably damaging Het
Slc27a6 T C 18: 58,598,733 F385S probably benign Het
Stk38l A G 6: 146,758,550 T27A probably benign Het
Tasp1 A G 2: 140,057,407 S9P probably damaging Het
Tcstv1 T A 13: 119,893,754 D114V probably damaging Het
Tmigd1 A T 11: 76,904,642 R25S probably benign Het
Tnrc6a T A 7: 123,174,296 Y1154N probably damaging Het
Tox2 T C 2: 163,203,171 V3A Het
Ubr1 A T 2: 120,925,988 D719E probably benign Het
Ubr3 A G 2: 69,965,478 K923R Het
Vmn2r12 C T 5: 109,086,337 V670M probably damaging Het
Zfp983 T C 17: 21,657,606 S9P probably benign Het
Zfp986 A T 4: 145,899,460 H230L probably damaging Het
Zscan4f G A 7: 11,401,314 E216K probably benign Het
Other mutations in Mertk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Mertk APN 2 128783967 missense probably damaging 1.00
IGL01561:Mertk APN 2 128736636 missense probably damaging 1.00
IGL01873:Mertk APN 2 128729275 missense possibly damaging 0.93
IGL02539:Mertk APN 2 128801290 missense probably damaging 1.00
IGL02652:Mertk APN 2 128801270 missense probably benign
IGL02962:Mertk APN 2 128777454 missense probably damaging 1.00
IGL03237:Mertk APN 2 128790272 missense probably damaging 1.00
PIT4378001:Mertk UTSW 2 128782617 critical splice donor site probably null
R0118:Mertk UTSW 2 128759166 missense probably damaging 0.99
R0281:Mertk UTSW 2 128782621 splice site probably benign
R0491:Mertk UTSW 2 128793107 critical splice donor site probably null
R0565:Mertk UTSW 2 128771483 missense probably benign 0.20
R0628:Mertk UTSW 2 128738313 missense probably damaging 1.00
R1260:Mertk UTSW 2 128762152 missense probably benign 0.03
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1423:Mertk UTSW 2 128778963 missense probably damaging 1.00
R1523:Mertk UTSW 2 128790328 critical splice donor site probably null
R1539:Mertk UTSW 2 128782526 missense probably benign 0.05
R1680:Mertk UTSW 2 128801636 missense probably benign 0.03
R1770:Mertk UTSW 2 128750174 missense probably benign 0.10
R1832:Mertk UTSW 2 128762212 missense probably benign 0.10
R1870:Mertk UTSW 2 128801196 missense probably benign 0.01
R1959:Mertk UTSW 2 128759090 missense probably damaging 0.98
R2078:Mertk UTSW 2 128794458 missense probably damaging 1.00
R2125:Mertk UTSW 2 128762138 missense probably benign
R2178:Mertk UTSW 2 128793064 missense probably damaging 1.00
R2220:Mertk UTSW 2 128801472 missense probably benign 0.18
R4128:Mertk UTSW 2 128777438 nonsense probably null
R4664:Mertk UTSW 2 128801212 missense probably benign 0.24
R4740:Mertk UTSW 2 128751994 missense probably damaging 1.00
R4822:Mertk UTSW 2 128801305 missense probably benign 0.00
R4839:Mertk UTSW 2 128782576 missense probably damaging 0.97
R4874:Mertk UTSW 2 128750159 missense probably damaging 1.00
R4899:Mertk UTSW 2 128783925 missense probably damaging 1.00
R5010:Mertk UTSW 2 128784000 missense probably benign 0.03
R5128:Mertk UTSW 2 128738247 missense probably damaging 0.97
R5251:Mertk UTSW 2 128729455 missense probably damaging 1.00
R5276:Mertk UTSW 2 128801314 missense possibly damaging 0.87
R5397:Mertk UTSW 2 128771464 missense possibly damaging 0.86
R5575:Mertk UTSW 2 128736565 missense probably damaging 1.00
R5605:Mertk UTSW 2 128738307 missense probably benign 0.43
R5705:Mertk UTSW 2 128771401 missense probably benign 0.00
R5987:Mertk UTSW 2 128771374 missense probably benign 0.01
R6127:Mertk UTSW 2 128738291 missense probably damaging 0.99
R6556:Mertk UTSW 2 128776421 missense probably benign 0.23
R6671:Mertk UTSW 2 128752023 critical splice donor site probably null
R6674:Mertk UTSW 2 128729357 missense probably benign
R6841:Mertk UTSW 2 128759230 splice site probably null
R7153:Mertk UTSW 2 128736649 missense probably damaging 0.99
R7192:Mertk UTSW 2 128793108 splice site probably null
R7225:Mertk UTSW 2 128801562 missense possibly damaging 0.94
R7344:Mertk UTSW 2 128771497 missense probably benign
R7414:Mertk UTSW 2 128729393 missense possibly damaging 0.95
R7883:Mertk UTSW 2 128776345 missense probably benign 0.01
R8000:Mertk UTSW 2 128771498 missense probably benign
R8953:Mertk UTSW 2 128778796 intron probably benign
R9135:Mertk UTSW 2 128762115 missense probably benign 0.23
R9176:Mertk UTSW 2 128778972 missense possibly damaging 0.62
X0067:Mertk UTSW 2 128729567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGTGCTGTTCCTGGTCCC -3'
(R):5'- GTTAACTCCATCAGCACCCAGG -3'

Sequencing Primer
(F):5'- CCACCCCTGAGCTGACCTTG -3'
(R):5'- GGTTTTACTCTCAGCCTCAGAAAG -3'
Posted On 2022-01-20