Mutagenetix > Incidental Mutations

Incidental Mutation 'R9153:Mertk'

695126

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R9153 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 128782567 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 633 (A633S)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

AlphaFold

Q60805

Predicted Effect

probably damaging
Transcript: ENSMUST00000014505
AA Change: A633S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: A633S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,216,655	S711R	possibly damaging	Het
Adnp	C	A	2: 168,184,660	Q238H	possibly damaging	Het
Akap13	A	G	7: 75,609,481	T618A	probably benign	Het
Ankfn1	G	A	11: 89,412,019	R58W	probably damaging	Het
Armc4	T	C	18: 7,286,733	K166R	possibly damaging	Het
Borcs5	G	T	6: 134,641,145		probably benign	Het
C1s1	T	C	6: 124,540,947	M25V	possibly damaging	Het
Canx	A	T	11: 50,297,335	D527E	probably benign	Het
Ccdc154	G	A	17: 25,163,178	D24N	probably damaging	Het
Ccnt1	G	A	15: 98,543,278	T703I	probably benign	Het
Cd46	T	C	1: 195,092,171	S19G	possibly damaging	Het
Cdc25b	G	A	2: 131,192,644	E264K	possibly damaging	Het
Cog5	A	C	12: 31,660,811	K63N	possibly damaging	Het
Col28a1	G	A	6: 8,022,765	T726I	probably benign	Het
Dhx40	A	G	11: 86,799,539	S219P	probably damaging	Het
Dnah12	T	A	14: 26,814,612	W2162R	probably damaging	Het
Eef1a2	A	G	2: 181,147,981	*464R	probably null	Het
Eif1a	T	A	18: 46,607,969	D90E	probably damaging	Het
Fasn	C	T	11: 120,815,670	R996Q	possibly damaging	Het
Foxred2	A	G	15: 77,955,587		probably null	Het
Frat2	A	G	19: 41,847,367	L182P	probably damaging	Het
Fxyd2	G	T	9: 45,408,311	V24F	probably damaging	Het
Gabrd	C	T	4: 155,386,039	V319I	probably damaging	Het
Gm28710	A	T	5: 16,835,918		probably null	Het
H13	T	G	2: 152,691,868	V267G	possibly damaging	Het
Hnf4g	T	C	3: 3,508,318		probably benign	Het
Iglon5	T	A	7: 43,475,997	T272S	possibly damaging	Het
Iqgap2	T	A	13: 95,708,039	M454L	probably benign	Het
Irf8	T	C	8: 120,753,661	C304R	probably benign	Het
Itga2	A	G	13: 114,865,405	F614L	probably benign	Het
Itgb4	A	C	11: 115,984,053	H412P	probably benign	Het
Jarid2	T	C	13: 44,911,202	F921S	probably damaging	Het
Kctd13	A	G	7: 126,942,155	D189G	probably damaging	Het
Meis2	G	T	2: 115,867,275	P381T	probably benign	Het
Morn5	A	G	2: 36,052,981	Y31C	probably damaging	Het
Mug2	A	T	6: 122,040,668	T455S	possibly damaging	Het
Myo3a	A	G	2: 22,399,933	N700S	probably benign	Het
Nisch	T	C	14: 31,174,825	T807A	unknown	Het
Nkx1-1	A	T	5: 33,431,359	V195E	unknown	Het
Numa1	A	G	7: 101,999,911	T950A	probably benign	Het
Nup160	A	G	2: 90,684,085	T126A	possibly damaging	Het
Oca2	C	T	7: 56,293,838	T253I	probably benign	Het
Olfr799	T	A	10: 129,647,437	I103N	possibly damaging	Het
P4ha1	A	G	10: 59,367,290	K435R	probably damaging	Het
Pcdhgb4	T	A	18: 37,721,078	N175K	possibly damaging	Het
Phactr3	A	T	2: 178,283,946	E338V	possibly damaging	Het
Plec	G	T	15: 76,180,525	R1782S	unknown	Het
Prpf39	A	T	12: 65,059,897	Q593L	probably damaging	Het
Ptprq	T	C	10: 107,580,265	Y1724C	probably damaging	Het
Pygo1	T	A	9: 72,944,861	V110D	possibly damaging	Het
Rasgrf1	T	A	9: 89,944,737	L133Q	probably damaging	Het
Rgs10	G	A	7: 128,374,009	R145C	probably damaging	Het
Secisbp2	A	G	13: 51,679,819	Y665C	possibly damaging	Het
Sel1l3	T	A	5: 53,135,846	T843S	probably benign	Het
Senp7	G	A	16: 56,186,123	V964I	probably benign	Het
Setd4	T	A	16: 93,587,834	D322V	possibly damaging	Het
Sftpc	T	A	14: 70,522,210	T90S	probably benign	Het
Shq1	A	T	6: 100,611,777	D382E	probably damaging	Het
Sim1	A	G	10: 50,895,933	R13G	probably damaging	Het
Slc27a6	T	C	18: 58,598,733	F385S	probably benign	Het
Stk38l	A	G	6: 146,758,550	T27A	probably benign	Het
Tasp1	A	G	2: 140,057,407	S9P	probably damaging	Het
Tcstv1	T	A	13: 119,893,754	D114V	probably damaging	Het
Tmigd1	A	T	11: 76,904,642	R25S	probably benign	Het
Tnrc6a	T	A	7: 123,174,296	Y1154N	probably damaging	Het
Tox2	T	C	2: 163,203,171	V3A		Het
Ubr1	A	T	2: 120,925,988	D719E	probably benign	Het
Ubr3	A	G	2: 69,965,478	K923R		Het
Vmn2r12	C	T	5: 109,086,337	V670M	probably damaging	Het
Zfp983	T	C	17: 21,657,606	S9P	probably benign	Het
Zfp986	A	T	4: 145,899,460	H230L	probably damaging	Het
Zscan4f	G	A	7: 11,401,314	E216K	probably benign	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
R8953:Mertk	UTSW	2	128778796	intron	probably benign
R9135:Mertk	UTSW	2	128762115	missense	probably benign	0.23
R9176:Mertk	UTSW	2	128778972	missense	possibly damaging	0.62
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAAGTGCTGTTCCTGGTCCC -3'
(R):5'- GTTAACTCCATCAGCACCCAGG -3'

Sequencing Primer
(F):5'- CCACCCCTGAGCTGACCTTG -3'
(R):5'- GGTTTTACTCTCAGCCTCAGAAAG -3'

Posted On

2022-01-20